\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910429389:

Variant ID: vg0910429389 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10429389
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATGACGATAGAAGAATCGTCACTAGATTAATGACAAAAAAATAAGGTTTCGTCATAGAACGCCATTAGAGACACATGATAGGTGACGAATGAATTTT[C/T]
GTCACGTGAGCGTCACAGATTTCACAACATGACGTAACATTCAGCGTTTGTGATGTAAATGAAACGTCACCTATCATAAGATCTCTTGTAGTGGACTCGT

Reverse complement sequence

ACGAGTCCACTACAAGAGATCTTATGATAGGTGACGTTTCATTTACATCACAAACGCTGAATGTTACGTCATGTTGTGAAATCTGTGACGCTCACGTGAC[G/A]
AAAATTCATTCGTCACCTATCATGTGTCTCTAATGGCGTTCTATGACGAAACCTTATTTTTTTGTCATTAATCTAGTGACGATTCTTCTATCGTCATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.40% 20.60% 13.08% 42.91% NA
All Indica  2759 14.60% 1.00% 20.22% 64.12% NA
All Japonica  1512 37.50% 58.70% 0.93% 2.91% NA
Aus  269 13.00% 6.30% 14.87% 65.80% NA
Indica I  595 17.60% 1.30% 20.00% 61.01% NA
Indica II  465 9.00% 0.90% 19.35% 70.75% NA
Indica III  913 18.20% 0.40% 21.47% 59.91% NA
Indica Intermediate  786 11.60% 1.50% 19.47% 67.43% NA
Temperate Japonica  767 61.80% 36.80% 1.04% 0.39% NA
Tropical Japonica  504 5.00% 88.50% 0.60% 5.95% NA
Japonica Intermediate  241 28.20% 66.00% 1.24% 4.56% NA
VI/Aromatic  96 68.80% 11.50% 1.04% 18.75% NA
Intermediate  90 40.00% 32.20% 5.56% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910429389 C -> DEL N N silent_mutation Average:13.286; most accessible tissue: Callus, score: 32.499 N N N N
vg0910429389 C -> T LOC_Os09g17020-LOC_Os09g17030 intergenic_region ; MODIFIER silent_mutation Average:13.286; most accessible tissue: Callus, score: 32.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910429389 NA 1.17E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 4.89E-14 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 5.37E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 4.41E-10 mr1338 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 4.85E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 2.39E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 5.21E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 2.48E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 1.50E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 1.82E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 8.49E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 2.77E-22 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 2.10E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 9.68E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 1.45E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 4.73E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 5.64E-09 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 3.96E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 8.93E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910429389 NA 2.45E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251