\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910414381:

Variant ID: vg0910414381 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10414381
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, A: 0.19, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGCCTTTGCTAAAACCCAGTTTGGCCTTCCCATTAAATGTTTTCAGGCGGATAATGGCACCGAATTTTTTAACCAGAACACAACCTCCTTTTTAGCCA[T/A]
CCTCGGTACCATCCTTCGCCTATCTTGTCCATACACTTCCCCACAAAATGGTAAAGCCGAACGCATGCTTCGCACCATCAACAATTCTATTCGCACTCTT

Reverse complement sequence

AAGAGTGCGAATAGAATTGTTGATGGTGCGAAGCATGCGTTCGGCTTTACCATTTTGTGGGGAAGTGTATGGACAAGATAGGCGAAGGATGGTACCGAGG[A/T]
TGGCTAAAAAGGAGGTTGTGTTCTGGTTAAAAAATTCGGTGCCATTATCCGCCTGAAAACATTTAATGGGAAGGCCAAACTGGGTTTTAGCAAAGGCAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 35.10% 6.20% 21.84% NA
All Indica  2759 57.40% 4.90% 8.45% 29.25% NA
All Japonica  1512 0.50% 91.50% 1.85% 6.22% NA
Aus  269 46.80% 8.20% 9.67% 35.32% NA
Indica I  595 38.70% 12.60% 12.77% 35.97% NA
Indica II  465 67.70% 3.40% 7.53% 21.29% NA
Indica III  913 61.80% 1.10% 6.46% 30.67% NA
Indica Intermediate  786 60.30% 4.50% 8.02% 27.23% NA
Temperate Japonica  767 0.30% 98.40% 0.52% 0.78% NA
Tropical Japonica  504 0.80% 81.50% 4.56% 13.10% NA
Japonica Intermediate  241 0.40% 90.00% 0.41% 9.13% NA
VI/Aromatic  96 12.50% 67.70% 0.00% 19.79% NA
Intermediate  90 14.40% 60.00% 6.67% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910414381 T -> DEL N N silent_mutation Average:29.529; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg0910414381 T -> A LOC_Os09g17010.1 downstream_gene_variant ; 3678.0bp to feature; MODIFIER silent_mutation Average:29.529; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg0910414381 T -> A LOC_Os09g17020.1 intron_variant ; MODIFIER silent_mutation Average:29.529; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910414381 2.24E-06 NA mr1179 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 2.39E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 5.66E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 3.02E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.51E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.00E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 3.68E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 5.14E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.41E-19 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.35E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.12E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 4.36E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.08E-12 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 5.33E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.43E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.59E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 3.07E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 1.23E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 4.16E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 8.68E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 8.97E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 4.11E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 2.01E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414381 NA 6.31E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251