Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910414094:

Variant ID: vg0910414094 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10414094
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCTATTCAGACTCTTCACAAATTAGCTATTCTTCCTTGTAACAAGATAGATCATAAGTTGTGTCATGCCTGTCAGTTAGGGAAACACACTCGTTTACC[G/A]
TTCTCTCGGTCTCAGTCTAGTACTTCTTCTCCTTTTGAGCTTGTTCACTGTGATGTGTGGACCTCTCCTGTCTTGAGTACTTCTGGCTTTAAGTATTACT

Reverse complement sequence

AGTAATACTTAAAGCCAGAAGTACTCAAGACAGGAGAGGTCCACACATCACAGTGAACAAGCTCAAAAGGAGAAGAAGTACTAGACTGAGACCGAGAGAA[C/T]
GGTAAACGAGTGTGTTTCCCTAACTGACAGGCATGACACAACTTATGATCTATCTTGTTACAAGGAAGAATAGCTAATTTGTGAAGAGTCTGAATAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.20%	11.00%	3.41%	23.36%	NA
All Indica	2759	44.60%	18.60%	5.26%	31.57%	NA
All Japonica	1512	91.90%	0.20%	0.46%	7.47%	NA
Aus	269	59.10%	0.70%	2.97%	37.17%	NA
Indica I	595	20.50%	29.90%	10.42%	39.16%	NA
Indica II	465	52.50%	19.80%	4.30%	23.44%	NA
Indica III	913	53.60%	11.00%	3.07%	32.42%	NA
Indica Intermediate	786	47.70%	18.20%	4.45%	29.64%	NA
Temperate Japonica	767	98.70%	0.00%	0.13%	1.17%	NA
Tropical Japonica	504	81.90%	0.60%	1.19%	16.27%	NA
Japonica Intermediate	241	90.90%	0.00%	0.00%	9.13%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	81.10%	3.30%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910414094	G -> DEL	N	N	silent_mutation	Average:28.924; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0910414094	G -> A	LOC_Os09g17010.1	downstream_gene_variant ; 3391.0bp to feature; MODIFIER	silent_mutation	Average:28.924; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0910414094	G -> A	LOC_Os09g17020.1	intron_variant ; MODIFIER	silent_mutation	Average:28.924; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910414094	NA	3.68E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	3.57E-09	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	8.99E-08	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	1.60E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	5.18E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	2.67E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	4.10E-06	mr1224	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	1.86E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	3.27E-08	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	3.32E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	4.89E-07	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	4.15E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	2.99E-06	1.47E-06	mr1471	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	1.18E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	2.41E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	7.95E-06	3.00E-06	mr1590	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	5.76E-07	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	3.52E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	4.34E-06	NA	mr1645	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	5.22E-06	mr1645	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	NA	1.71E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	3.60E-06	1.23E-06	mr1768	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910414094	5.45E-06	1.40E-06	mr1811	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251