\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910413877:

Variant ID: vg0910413877 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10413877
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGTTTGACAATTCACTCGAGACAATAAATGTTCTATTGAGTTTGATGAGTTTGGTTTTTCTGTTAAGGACCTTCGGACCCGGCGCGTGATTCTTCGCT[G/A]
CAATAGTCGCGGTGATCTCTACACTTCACCTACTGCCGTCCCTAGCATTGCTGCTCACAGCTTCCTTGCCGAATCCTCTACATTGTGGCATCGTCGACTT

Reverse complement sequence

AAGTCGACGATGCCACAATGTAGAGGATTCGGCAAGGAAGCTGTGAGCAGCAATGCTAGGGACGGCAGTAGGTGAAGTGTAGAGATCACCGCGACTATTG[C/T]
AGCGAAGAATCACGCGCCGGGTCCGAAGGTCCTTAACAGAAAAACCAAACTCATCAAACTCAATAGAACATTTATTGTCTCGAGTGAATTGTCAAACTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 12.70% 3.36% 22.96% NA
All Indica  2759 42.30% 21.30% 5.22% 31.17% NA
All Japonica  1512 91.90% 0.40% 0.26% 7.47% NA
Aus  269 59.90% 1.50% 4.09% 34.57% NA
Indica I  595 20.00% 30.90% 10.25% 38.82% NA
Indica II  465 53.10% 19.80% 3.87% 23.23% NA
Indica III  913 52.20% 12.70% 3.18% 31.87% NA
Indica Intermediate  786 41.10% 25.10% 4.58% 29.26% NA
Temperate Japonica  767 99.00% 0.00% 0.00% 1.04% NA
Tropical Japonica  504 81.70% 1.00% 0.60% 16.67% NA
Japonica Intermediate  241 90.50% 0.40% 0.41% 8.71% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 83.30% 3.30% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910413877 G -> DEL N N silent_mutation Average:32.476; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0910413877 G -> A LOC_Os09g17010.1 downstream_gene_variant ; 3174.0bp to feature; MODIFIER silent_mutation Average:32.476; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N
vg0910413877 G -> A LOC_Os09g17020.1 intron_variant ; MODIFIER silent_mutation Average:32.476; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910413877 NA 3.40E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 1.41E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 4.20E-08 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 1.76E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 1.10E-06 NA mr1155 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 8.99E-06 2.97E-10 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 2.28E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 3.45E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 4.69E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 5.00E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 4.58E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 1.61E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 5.62E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 5.98E-07 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 9.12E-07 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 1.00E-07 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 2.34E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910413877 NA 2.53E-06 mr1768 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251