\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910406964:

Variant ID: vg0910406964 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10406964
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.50, C: 0.50, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACGATAAAAGATCACTGGTGGTTGGTCTGGAGCTTGTTCAACTCCGGCGAGACAGTGTCACCCTTCGTCCTTCGATGCACGCGGTTGTGGTACAAAT[C/T]
GAGATCCACTGTAGAAACTGAAGAGAACCCCTCCGGTACCATGTCGGCTCAACTGGCCACCTAGTTTGCCCCATCTTCTGCTTTTTTTAAACAAAACACA

Reverse complement sequence

TGTGTTTTGTTTAAAAAAAGCAGAAGATGGGGCAAACTAGGTGGCCAGTTGAGCCGACATGGTACCGGAGGGGTTCTCTTCAGTTTCTACAGTGGATCTC[G/A]
ATTTGTACCACAACCGCGTGCATCGAAGGACGAAGGGTGACACTGTCTCGCCGGAGTTGAACAAGCTCCAGACCAACCACCAGTGATCTTTTATCGTGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.80% 16.60% 0.42% 62.19% NA
All Indica  2759 1.00% 4.50% 0.51% 94.02% NA
All Japonica  1512 58.80% 37.00% 0.20% 3.97% NA
Aus  269 7.10% 4.10% 0.00% 88.85% NA
Indica I  595 1.20% 12.10% 0.50% 86.22% NA
Indica II  465 1.10% 2.20% 0.00% 96.77% NA
Indica III  913 0.30% 1.10% 0.55% 98.03% NA
Indica Intermediate  786 1.70% 3.90% 0.76% 93.64% NA
Temperate Japonica  767 37.40% 60.60% 0.39% 1.56% NA
Tropical Japonica  504 88.10% 5.40% 0.00% 6.55% NA
Japonica Intermediate  241 65.60% 28.20% 0.00% 6.22% NA
VI/Aromatic  96 17.70% 62.50% 0.00% 19.79% NA
Intermediate  90 34.40% 32.20% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910406964 C -> DEL N N silent_mutation Average:13.798; most accessible tissue: Callus, score: 74.264 N N N N
vg0910406964 C -> T LOC_Os09g17000.1 upstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:13.798; most accessible tissue: Callus, score: 74.264 N N N N
vg0910406964 C -> T LOC_Os09g17010.1 upstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:13.798; most accessible tissue: Callus, score: 74.264 N N N N
vg0910406964 C -> T LOC_Os09g17000.2 upstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:13.798; most accessible tissue: Callus, score: 74.264 N N N N
vg0910406964 C -> T LOC_Os09g17000-LOC_Os09g17010 intergenic_region ; MODIFIER silent_mutation Average:13.798; most accessible tissue: Callus, score: 74.264 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910406964 NA 6.00E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 1.92E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 1.91E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 2.82E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 2.27E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 2.37E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 9.77E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 4.44E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 3.85E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 2.86E-22 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 4.86E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 1.11E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 9.61E-10 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 5.51E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 6.20E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 6.17E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 2.38E-06 1.32E-20 mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 5.39E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 4.30E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910406964 NA 7.08E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251