\
| Variant ID: vg0910353994 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10353994 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGACACATTTAAAGAATGTGGAGTATGGTAGAGATTTTGTGAATAAATCAGCAAGATTATCACATGACTTAGTTTGTAAGATGTTTATCTCTCCATGTTG[C/T]
TGAAACTCATGAGGATAAAATAATTTAGGAGCAATATGCTTAGTGATGTTACTCTTAATATAACCAATTTCCATCTGAACAACACAAGCGGCATTATCTT
AAGATAATGCCGCTTGTGTTGTTCAGATGGAAATTGGTTATATTAAGAGTAACATCACTAAGCATATTGCTCCTAAATTATTTTATCCTCATGAGTTTCA[G/A]
CAACATGGAGAGATAAACATCTTACAAACTAAGTCATGTGATAATCTTGCTGATTTATTCACAAAATCTCTACCATACTCCACATTCTTTAAATGTGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.40% | 0.10% | 35.67% | 41.77% | NA |
| All Indica | 2759 | 14.50% | 0.00% | 23.92% | 61.58% | NA |
| All Japonica | 1512 | 38.50% | 0.30% | 48.61% | 12.57% | NA |
| Aus | 269 | 4.80% | 0.40% | 75.46% | 19.33% | NA |
| Indica I | 595 | 9.60% | 0.00% | 6.05% | 84.37% | NA |
| Indica II | 465 | 36.10% | 0.00% | 21.51% | 42.37% | NA |
| Indica III | 913 | 4.50% | 0.00% | 38.34% | 57.17% | NA |
| Indica Intermediate | 786 | 16.90% | 0.10% | 22.14% | 60.81% | NA |
| Temperate Japonica | 767 | 63.00% | 0.30% | 21.90% | 14.86% | NA |
| Tropical Japonica | 504 | 7.30% | 0.40% | 83.13% | 9.13% | NA |
| Japonica Intermediate | 241 | 25.70% | 0.40% | 61.41% | 12.45% | NA |
| VI/Aromatic | 96 | 26.00% | 0.00% | 61.46% | 12.50% | NA |
| Intermediate | 90 | 44.40% | 0.00% | 32.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910353994 | C -> DEL | LOC_Os09g16930.1 | N | frameshift_variant | Average:11.894; most accessible tissue: Callus, score: 22.81 | N | N | N | N |
| vg0910353994 | C -> T | LOC_Os09g16930.1 | synonymous_variant ; p.Gln1037Gln; LOW | synonymous_codon | Average:11.894; most accessible tissue: Callus, score: 22.81 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910353994 | NA | 6.61E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 2.11E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 8.32E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 4.57E-19 | mr1164 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 6.53E-14 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 2.01E-11 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 6.62E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 1.29E-11 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 1.78E-21 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 8.34E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 5.40E-21 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 3.67E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 4.05E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 5.44E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 3.90E-19 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910353994 | NA | 7.88E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |