\
| Variant ID: vg0910273304 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10273304 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCGTGTCCAACTTTACCGTGCTACTGATTCTCTATACCTTCGGGAGTGGAGCAAAGACGGCCTGCATCTTCTCCACCTTCACCGGCGCCGACGAGGAGCT[G/C]
CGGCTGCGCCTCACAAGAAGCATGGACCTCGGTGACCTTATCCGGCCCAAGGGCGTCCCAAGGAGACAGAGACATTTCGATGCCGACGCCATGCACTTCG
CGAAGTGCATGGCGTCGGCATCGAAATGTCTCTGTCTCCTTGGGACGCCCTTGGGCCGGATAAGGTCACCGAGGTCCATGCTTCTTGTGAGGCGCAGCCG[C/G]
AGCTCCTCGTCGGCGCCGGTGAAGGTGGAGAAGATGCAGGCCGTCTTTGCTCCACTCCCGAAGGTATAGAGAATCAGTAGCACGGTAAAGTTGGACACGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 23.40% | 1.10% | 35.19% | NA |
| All Indica | 2759 | 36.90% | 2.70% | 1.70% | 58.72% | NA |
| All Japonica | 1512 | 40.30% | 59.10% | 0.26% | 0.33% | NA |
| Aus | 269 | 82.90% | 7.80% | 0.37% | 8.92% | NA |
| Indica I | 595 | 9.10% | 6.70% | 2.18% | 82.02% | NA |
| Indica II | 465 | 57.60% | 1.90% | 1.51% | 38.92% | NA |
| Indica III | 913 | 43.60% | 0.50% | 1.20% | 54.65% | NA |
| Indica Intermediate | 786 | 37.80% | 2.70% | 2.04% | 57.51% | NA |
| Temperate Japonica | 767 | 58.90% | 40.30% | 0.52% | 0.26% | NA |
| Tropical Japonica | 504 | 15.30% | 84.10% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 80.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 41.10% | 45.60% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910273304 | G -> DEL | LOC_Os09g16810.1 | N | frameshift_variant | Average:14.386; most accessible tissue: Callus, score: 65.86 | N | N | N | N |
| vg0910273304 | G -> C | LOC_Os09g16810.1 | synonymous_variant ; p.Leu217Leu; LOW | synonymous_codon | Average:14.386; most accessible tissue: Callus, score: 65.86 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910273304 | NA | 4.25E-11 | mr1174 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 2.23E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 5.71E-06 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 9.00E-07 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 7.51E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 4.53E-08 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 2.25E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 2.84E-06 | mr1149_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 2.88E-09 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 1.49E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 8.53E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 1.06E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 5.73E-07 | mr1441_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 6.42E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910273304 | NA | 4.64E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |