\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910273304:

Variant ID: vg0910273304 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10273304
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGTGTCCAACTTTACCGTGCTACTGATTCTCTATACCTTCGGGAGTGGAGCAAAGACGGCCTGCATCTTCTCCACCTTCACCGGCGCCGACGAGGAGCT[G/C]
CGGCTGCGCCTCACAAGAAGCATGGACCTCGGTGACCTTATCCGGCCCAAGGGCGTCCCAAGGAGACAGAGACATTTCGATGCCGACGCCATGCACTTCG

Reverse complement sequence

CGAAGTGCATGGCGTCGGCATCGAAATGTCTCTGTCTCCTTGGGACGCCCTTGGGCCGGATAAGGTCACCGAGGTCCATGCTTCTTGTGAGGCGCAGCCG[C/G]
AGCTCCTCGTCGGCGCCGGTGAAGGTGGAGAAGATGCAGGCCGTCTTTGCTCCACTCCCGAAGGTATAGAGAATCAGTAGCACGGTAAAGTTGGACACGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 23.40% 1.10% 35.19% NA
All Indica  2759 36.90% 2.70% 1.70% 58.72% NA
All Japonica  1512 40.30% 59.10% 0.26% 0.33% NA
Aus  269 82.90% 7.80% 0.37% 8.92% NA
Indica I  595 9.10% 6.70% 2.18% 82.02% NA
Indica II  465 57.60% 1.90% 1.51% 38.92% NA
Indica III  913 43.60% 0.50% 1.20% 54.65% NA
Indica Intermediate  786 37.80% 2.70% 2.04% 57.51% NA
Temperate Japonica  767 58.90% 40.30% 0.52% 0.26% NA
Tropical Japonica  504 15.30% 84.10% 0.00% 0.60% NA
Japonica Intermediate  241 33.60% 66.40% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 80.20% 0.00% 2.08% NA
Intermediate  90 41.10% 45.60% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910273304 G -> DEL LOC_Os09g16810.1 N frameshift_variant Average:14.386; most accessible tissue: Callus, score: 65.86 N N N N
vg0910273304 G -> C LOC_Os09g16810.1 synonymous_variant ; p.Leu217Leu; LOW synonymous_codon Average:14.386; most accessible tissue: Callus, score: 65.86 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910273304 NA 4.25E-11 mr1174 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 2.23E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 5.71E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 9.00E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 7.51E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 4.53E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 2.25E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 2.84E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 2.88E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 1.49E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 8.53E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 1.06E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 5.73E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 6.42E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910273304 NA 4.64E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251