\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910262904:

Variant ID: vg0910262904 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10262904
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGAGTAAAATTTTGCTGGCAATTACTTTTGGAGGGAAAGTATGTTTTGCTGGCCGATTTATGCGTGCGTGCATAACAAATTAGTTTGTTTGTGCTGAT[C/A]
CAAAATATTTGTTCACCAGCATTTGTTAACAAGCTCTCGTAAACAAATATGGCAATTGTTTAATGAATCAATAACCTGTGGAGTGAAAAAAAATGATACA

Reverse complement sequence

TGTATCATTTTTTTTCACTCCACAGGTTATTGATTCATTAAACAATTGCCATATTTGTTTACGAGAGCTTGTTAACAAATGCTGGTGAACAAATATTTTG[G/T]
ATCAGCACAAACAAACTAATTTGTTATGCACGCACGCATAAATCGGCCAGCAAAACATACTTTCCCTCCAAAAGTAATTGCCAGCAAAATTTTACTCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 5.10% 24.12% 4.55% NA
All Indica  2759 44.80% 8.70% 39.65% 6.85% NA
All Japonica  1512 99.70% 0.00% 0.26% 0.07% NA
Aus  269 79.90% 0.40% 12.27% 7.43% NA
Indica I  595 18.70% 7.10% 69.92% 4.37% NA
Indica II  465 61.70% 5.40% 24.52% 8.39% NA
Indica III  913 53.00% 11.80% 27.16% 8.00% NA
Indica Intermediate  786 45.20% 8.10% 40.20% 6.49% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 84.40% 2.20% 8.89% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910262904 C -> DEL N N silent_mutation Average:12.36; most accessible tissue: Callus, score: 30.426 N N N N
vg0910262904 C -> A LOC_Os09g16780.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:12.36; most accessible tissue: Callus, score: 30.426 N N N N
vg0910262904 C -> A LOC_Os09g16790.1 upstream_gene_variant ; 458.0bp to feature; MODIFIER silent_mutation Average:12.36; most accessible tissue: Callus, score: 30.426 N N N N
vg0910262904 C -> A LOC_Os09g16780-LOC_Os09g16790 intergenic_region ; MODIFIER silent_mutation Average:12.36; most accessible tissue: Callus, score: 30.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910262904 NA 4.53E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 1.40E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 2.39E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 4.19E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 7.88E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 5.38E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 3.24E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 8.74E-12 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 7.70E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 5.88E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 2.76E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 6.80E-10 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 4.21E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 1.09E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 3.92E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 3.20E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 3.26E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 7.71E-10 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 7.75E-07 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 2.88E-07 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 8.52E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 5.04E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 2.42E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 1.57E-09 mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 5.95E-07 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 1.82E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904 NA 1.82E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251