Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910262904:

Variant ID: vg0910262904 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10262904
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGGAGTAAAATTTTGCTGGCAATTACTTTTGGAGGGAAAGTATGTTTTGCTGGCCGATTTATGCGTGCGTGCATAACAAATTAGTTTGTTTGTGCTGAT[C/A]
CAAAATATTTGTTCACCAGCATTTGTTAACAAGCTCTCGTAAACAAATATGGCAATTGTTTAATGAATCAATAACCTGTGGAGTGAAAAAAAATGATACA

Reverse complement sequence

TGTATCATTTTTTTTCACTCCACAGGTTATTGATTCATTAAACAATTGCCATATTTGTTTACGAGAGCTTGTTAACAAATGCTGGTGAACAAATATTTTG[G/T]
ATCAGCACAAACAAACTAATTTGTTATGCACGCACGCATAAATCGGCCAGCAAAACATACTTTCCCTCCAAAAGTAATTGCCAGCAAAATTTTACTCCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	5.10%	24.12%	4.55%	NA
All Indica	2759	44.80%	8.70%	39.65%	6.85%	NA
All Japonica	1512	99.70%	0.00%	0.26%	0.07%	NA
Aus	269	79.90%	0.40%	12.27%	7.43%	NA
Indica I	595	18.70%	7.10%	69.92%	4.37%	NA
Indica II	465	61.70%	5.40%	24.52%	8.39%	NA
Indica III	913	53.00%	11.80%	27.16%	8.00%	NA
Indica Intermediate	786	45.20%	8.10%	40.20%	6.49%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	84.40%	2.20%	8.89%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910262904	C -> DEL	N	N	silent_mutation	Average:12.36; most accessible tissue: Callus, score: 30.426	N	N	N	N
vg0910262904	C -> A	LOC_Os09g16780.1	upstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:12.36; most accessible tissue: Callus, score: 30.426	N	N	N	N
vg0910262904	C -> A	LOC_Os09g16790.1	upstream_gene_variant ; 458.0bp to feature; MODIFIER	silent_mutation	Average:12.36; most accessible tissue: Callus, score: 30.426	N	N	N	N
vg0910262904	C -> A	LOC_Os09g16780-LOC_Os09g16790	intergenic_region ; MODIFIER	silent_mutation	Average:12.36; most accessible tissue: Callus, score: 30.426	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910262904	NA	4.53E-10	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	1.40E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	2.39E-06	mr1168	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	4.19E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	7.88E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	5.38E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	3.24E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	8.74E-12	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	7.70E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	5.88E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	2.76E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	6.80E-10	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	4.21E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	1.09E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	3.92E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	3.20E-06	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	3.26E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	7.71E-10	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	7.75E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	2.88E-07	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	8.52E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	5.04E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	2.42E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	1.57E-09	mr1910_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	5.95E-07	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	1.82E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910262904	NA	1.82E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251