| Variant ID: vg0910261090 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10261090 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGTCTGCAGATTGTTCTAAACAAATCAAAGAAAATATGTAAGTCCATATTAAAAAAACTCATGCAGTAAAATGTAGGTAACAGACATTTTTGTTTACCA[G/A]
AATTTCTTCGCCATTAGGAACGGACCATGTTCCATTCTTCAAATAAGTTGCCTTCCAAACATCTATAGCACTAGGCCATTCACCTGTCACTAGGTTTCTC
GAGAAACCTAGTGACAGGTGAATGGCCTAGTGCTATAGATGTTTGGAAGGCAACTTATTTGAAGAATGGAACATGGTCCGTTCCTAATGGCGAAGAAATT[C/T]
TGGTAAACAAAAATGTCTGTTACCTACATTTTACTGCATGAGTTTTTTTAATATGGACTTACATATTTTCTTTGATTTGTTTAGAACAATCTGCAGACAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 5.30% | 4.19% | 25.79% | NA |
| All Indica | 2759 | 49.60% | 1.60% | 6.74% | 42.08% | NA |
| All Japonica | 1512 | 88.20% | 11.20% | 0.26% | 0.33% | NA |
| Aus | 269 | 81.00% | 1.50% | 1.86% | 15.61% | NA |
| Indica I | 595 | 28.40% | 5.70% | 5.04% | 60.84% | NA |
| Indica II | 465 | 64.90% | 0.40% | 3.44% | 31.18% | NA |
| Indica III | 913 | 54.10% | 0.20% | 8.43% | 37.24% | NA |
| Indica Intermediate | 786 | 51.30% | 0.80% | 8.02% | 39.95% | NA |
| Temperate Japonica | 767 | 86.00% | 13.20% | 0.52% | 0.26% | NA |
| Tropical Japonica | 504 | 93.30% | 6.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 27.10% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 77.80% | 8.90% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910261090 | G -> DEL | LOC_Os09g16780.1 | N | frameshift_variant | Average:7.906; most accessible tissue: Callus, score: 40.28 | N | N | N | N |
| vg0910261090 | G -> A | LOC_Os09g16780.1 | splice_region_variant&synonymous_variant ; p.Leu233Leu; LOW | synonymous_codon | Average:7.906; most accessible tissue: Callus, score: 40.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910261090 | 3.55E-06 | 3.55E-06 | mr1355 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910261090 | 4.68E-06 | 6.38E-06 | mr1728_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910261090 | NA | 8.62E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910261090 | 8.94E-07 | 8.94E-07 | mr1912_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |