\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910252196:

Variant ID: vg0910252196 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 10252196
Reference Allele: TAlternative Allele: C,TCTATCC
Primary Allele: TSecondary Allele: TCTATCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGCCGGCCATATCCATCCGCCCGTCCTTATCCATCCGCCTTATCCATCCATCCGACCGAGTCGCTCACGTCTCTCTCTCGCTCTTGCTCTCTCGCCTC[T/C,TCTATCC]
CTCTCTCGCCTCCCTCTATCCCTCTCTCTCTCTCTCTCTCGGCGGCCCGGCGGTGGCCCGTCGAGGTAGGCGTGGCGGTGGCTGGCAACGGCGCGCCCTC

Reverse complement sequence

GAGGGCGCGCCGTTGCCAGCCACCGCCACGCCTACCTCGACGGGCCACCGCCGGGCCGCCGAGAGAGAGAGAGAGAGAGGGATAGAGGGAGGCGAGAGAG[A/G,GGATAGA]
GAGGCGAGAGAGCAAGAGCGAGAGAGAGACGTGAGCGACTCGGTCGGATGGATGGATAAGGCGGATGGATAAGGACGGGCGGATGGATATGGCCGGCTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TCTATCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.40% 0.00% 0.70% 2.88% C: 0.02%
All Indica  2759 94.50% 0.10% 0.80% 4.68% NA
All Japonica  1512 99.60% 0.00% 0.20% 0.13% C: 0.07%
Aus  269 98.50% 0.00% 1.12% 0.37% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 76.10% 0.00% 1.72% 22.15% NA
Indica III  913 99.20% 0.10% 0.33% 0.33% NA
Indica Intermediate  786 95.70% 0.10% 1.27% 2.93% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.00% C: 0.20%
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 94.40% 0.00% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910252196 T -> DEL N N silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N
vg0910252196 T -> TCTATCC LOC_Os09g16760.1 5_prime_UTR_variant ; 889.0bp to feature; MODIFIER silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N
vg0910252196 T -> TCTATCC LOC_Os09g16750.1 upstream_gene_variant ; 4701.0bp to feature; MODIFIER silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N
vg0910252196 T -> TCTATCC LOC_Os09g16770.1 downstream_gene_variant ; 4064.0bp to feature; MODIFIER silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N
vg0910252196 T -> C LOC_Os09g16760.1 5_prime_UTR_variant ; 892.0bp to feature; MODIFIER silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N
vg0910252196 T -> C LOC_Os09g16750.1 upstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N
vg0910252196 T -> C LOC_Os09g16770.1 downstream_gene_variant ; 4065.0bp to feature; MODIFIER silent_mutation Average:99.223; most accessible tissue: Zhenshan97 flower, score: 99.82 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910252196 T C 0.16 0.11 0.07 0.08 0.08 0.11
vg0910252196 T TCTAT* 1.9 1.4 1.2 1.48 1.62 1.76

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910252196 1.71E-06 1.71E-06 mr1674 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251