Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910198203:

Variant ID: vg0910198203 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10198203
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCTCCGCGGCGTTCATAAAATTTATTACGCCATTTCTGTACTTCAGAAAATGACGTTTCACAGTTGTCGCATACATTCAACTTCGATCAATTGCTACA[T/G,A]
AATGAAAAAACAAATTAGAGGCACATCTTATAAGATCAGTATTGCTAAAGTAAGACGTGATGAAATTGCTGAATTAATGATTAGTATTACTCACTTGATT

Reverse complement sequence

AATCAAGTGAGTAATACTAATCATTAATTCAGCAATTTCATCACGTCTTACTTTAGCAATACTGATCTTATAAGATGTGCCTCTAATTTGTTTTTTCATT[A/C,T]
TGTAGCAATTGATCGAAGTTGAATGTATGCGACAACTGTGAAACGTCATTTTCTGAAGTACAGAAATGGCGTAATAAATTTTATGAACGCCGCGGAGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.60%	35.80%	1.21%	24.42%	A: 0.04%
All Indica	2759	61.80%	3.30%	1.49%	33.38%	NA
All Japonica	1512	1.80%	95.50%	0.20%	2.51%	NA
Aus	269	26.40%	8.60%	1.86%	63.20%	NA
Indica I	595	87.60%	6.40%	0.00%	6.05%	NA
Indica II	465	45.40%	2.60%	0.65%	51.40%	NA
Indica III	913	52.90%	1.00%	3.83%	42.28%	NA
Indica Intermediate	786	62.50%	4.10%	0.38%	33.08%	NA
Temperate Japonica	767	0.40%	98.30%	0.00%	1.30%	NA
Tropical Japonica	504	4.80%	91.90%	0.20%	3.17%	NA
Japonica Intermediate	241	0.00%	94.20%	0.83%	4.98%	NA
VI/Aromatic	96	2.10%	80.20%	4.17%	11.46%	A: 2.08%
Intermediate	90	17.80%	62.20%	4.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910198203	T -> G	LOC_Os09g16620.1	upstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> G	LOC_Os09g16630.1	upstream_gene_variant ; 215.0bp to feature; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> G	LOC_Os09g16640.1	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> G	LOC_Os09g16630-LOC_Os09g16640	intergenic_region ; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> DEL	N	N	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> A	LOC_Os09g16620.1	upstream_gene_variant ; 1545.0bp to feature; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> A	LOC_Os09g16630.1	upstream_gene_variant ; 215.0bp to feature; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> A	LOC_Os09g16640.1	upstream_gene_variant ; 1596.0bp to feature; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N
vg0910198203	T -> A	LOC_Os09g16630-LOC_Os09g16640	intergenic_region ; MODIFIER	silent_mutation	Average:27.418; most accessible tissue: Zhenshan97 root, score: 38.035	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910198203	NA	2.01E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	3.90E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	9.77E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	1.29E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	7.55E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	8.38E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	1.51E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	6.12E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	4.54E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	4.18E-08	mr1824	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	4.39E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	2.57E-10	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	4.53E-25	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	4.21E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	7.27E-06	NA	mr1728_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	3.02E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	2.00E-15	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	1.25E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	3.85E-07	NA	mr1860_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910198203	NA	5.59E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251