\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910187686:

Variant ID: vg0910187686 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10187686
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.40, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCGGTCGGCCTCGGTCTCCTACCATGGCGTCGCTCCTGCCTTGGACTCACCGAGCCAAAACACATGTATATGTATACATGCATCCATGTACTGCCAAC[T/C]
ACTGCAGTACACTTGCATGCATCGATCAATACCACACATATGCATGCTACAGTACCACGTGTACTATAGCACCATGTACTCTTCCTCAATTTCTCACTCC

Reverse complement sequence

GGAGTGAGAAATTGAGGAAGAGTACATGGTGCTATAGTACACGTGGTACTGTAGCATGCATATGTGTGGTATTGATCGATGCATGCAAGTGTACTGCAGT[A/G]
GTTGGCAGTACATGGATGCATGTATACATATACATGTGTTTTGGCTCGGTGAGTCCAAGGCAGGAGCGACGCCATGGTAGGAGACCGAGGCCGACCGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 36.30% 5.10% 19.89% NA
All Indica  2759 62.00% 3.70% 7.83% 26.42% NA
All Japonica  1512 1.70% 95.70% 0.13% 2.45% NA
Aus  269 24.50% 11.20% 6.69% 57.62% NA
Indica I  595 87.40% 6.40% 0.34% 5.88% NA
Indica II  465 45.60% 3.20% 7.31% 43.87% NA
Indica III  913 53.50% 1.20% 15.77% 29.57% NA
Indica Intermediate  786 62.50% 5.00% 4.58% 27.99% NA
Temperate Japonica  767 0.10% 98.70% 0.00% 1.17% NA
Tropical Japonica  504 5.00% 91.90% 0.00% 3.17% NA
Japonica Intermediate  241 0.00% 94.20% 0.83% 4.98% NA
VI/Aromatic  96 5.20% 83.30% 4.17% 7.29% NA
Intermediate  90 22.20% 63.30% 1.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910187686 T -> DEL N N silent_mutation Average:81.147; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0910187686 T -> C LOC_Os09g16590.1 downstream_gene_variant ; 1102.0bp to feature; MODIFIER silent_mutation Average:81.147; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0910187686 T -> C LOC_Os09g16600.1 downstream_gene_variant ; 1565.0bp to feature; MODIFIER silent_mutation Average:81.147; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N
vg0910187686 T -> C LOC_Os09g16590-LOC_Os09g16600 intergenic_region ; MODIFIER silent_mutation Average:81.147; most accessible tissue: Minghui63 flag leaf, score: 91.692 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0910187686 T C 0.01 0.01 0.0 0.07 0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910187686 NA 1.79E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 2.78E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 1.54E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 2.63E-06 NA mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 1.96E-06 1.15E-12 mr1307 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 6.06E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 9.74E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 1.50E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 1.72E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 2.70E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 2.45E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 1.66E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 4.27E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 1.21E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 8.86E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 1.99E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 3.60E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 6.50E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 4.50E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 4.33E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910187686 NA 2.14E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251