\
| Variant ID: vg0910147323 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10147323 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )
AGACGTGCAGGTAAATGGAATTTCTTGAGGACTGAGGTCAGGAGCTCACTGAAAGGAAAAGAAAGGGGAACAAGTGGACATCCTAAAAATTAATCTCTAA[A/G]
GGCCCCTTTGAATCGTAGGAATGAAAAAAAATAGAGGAATAGGAAAAACACAGGATTCGGACAGAAATACAATTGTAAAACAGAGGATTGCAAAACACAG
CTGTGTTTTGCAATCCTCTGTTTTACAATTGTATTTCTGTCCGAATCCTGTGTTTTTCCTATTCCTCTATTTTTTTTCATTCCTACGATTCAAAGGGGCC[T/C]
TTAGAGATTAATTTTTAGGATGTCCACTTGTTCCCCTTTCTTTTCCTTTCAGTGAGCTCCTGACCTCAGTCCTCAAGAAATTCCATTTACCTGCACGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 35.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 93.20% | 6.60% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 84.50% | 15.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 10.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 5.50% | 94.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.50% | 89.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 43.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910147323 | A -> G | LOC_Os09g16530.1 | downstream_gene_variant ; 2082.0bp to feature; MODIFIER | silent_mutation | Average:84.246; most accessible tissue: Zhenshan97 root, score: 95.258 | N | N | N | N |
| vg0910147323 | A -> G | LOC_Os09g16530-LOC_Os09g16540 | intergenic_region ; MODIFIER | silent_mutation | Average:84.246; most accessible tissue: Zhenshan97 root, score: 95.258 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910147323 | NA | 2.81E-21 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 1.51E-11 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 1.18E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 3.30E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 1.53E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 2.56E-11 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 4.93E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 2.62E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 3.59E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 1.91E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 5.26E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 1.42E-09 | mr1768_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910147323 | NA | 2.44E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |