\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910124666:

Variant ID: vg0910124666 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10124666
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATTTGATGATGAATCAAGTCACAATAAAATAAATGATAATTATATAAATTTTTTGAATAAGACGAATGGTCAAACGTTAGATAAAAAGGCAACGACGT[C/T]
ATACATTAAAATATGGAGGTAGTAATTATTTTGAATTTGAAATATTTAACTGCAAGTGTCTTAATTAGGAAATCATCTAATTATACTATCTAATTAAGAA

Reverse complement sequence

TTCTTAATTAGATAGTATAATTAGATGATTTCCTAATTAAGACACTTGCAGTTAAATATTTCAAATTCAAAATAATTACTACCTCCATATTTTAATGTAT[G/A]
ACGTCGTTGCCTTTTTATCTAACGTTTGACCATTCGTCTTATTCAAAAAATTTATATAATTATCATTTATTTTATTGTGACTTGATTCATCATCAAATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 43.90% 0.47% 0.00% NA
All Indica  2759 90.80% 8.70% 0.51% 0.00% NA
All Japonica  1512 0.90% 98.70% 0.40% 0.00% NA
Aus  269 27.10% 72.50% 0.37% 0.00% NA
Indica I  595 93.60% 5.90% 0.50% 0.00% NA
Indica II  465 91.80% 8.00% 0.22% 0.00% NA
Indica III  913 90.80% 8.20% 0.99% 0.00% NA
Indica Intermediate  786 88.20% 11.70% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 98.60% 0.52% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.83% 0.00% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910124666 C -> T LOC_Os09g16510.1 upstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:68.991; most accessible tissue: Minghui63 root, score: 89.131 N N N N
vg0910124666 C -> T LOC_Os09g16500-LOC_Os09g16510 intergenic_region ; MODIFIER silent_mutation Average:68.991; most accessible tissue: Minghui63 root, score: 89.131 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910124666 NA 7.31E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 1.03E-14 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 1.79E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 1.05E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 9.01E-25 mr1580 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 5.05E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 3.03E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 4.13E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 1.36E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 5.52E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 2.38E-32 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910124666 NA 9.36E-31 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251