\
| Variant ID: vg0910097490 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10097490 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )
GTCCTCATCATGGGATGGACGACTGGCTTATCTTGTAAAACATCTATAATGGACTCACTCCCATGTCCCGTGACTACCTGGACGCGACATCTTGGGGCAT[C/T]
CGTTCCTTAGCACCGTAGGAGCCAACATTGACGTGGGAACGGGGAGTATCCGTTTCCATATTAACGGGAAGGAAGAAAAGTTTGAGTGTCAGAATCAAGT
ACTTGATTCTGACACTCAAACTTTTCTTCCTTCCCGTTAATATGGAAACGGATACTCCCCGTTCCCACGTCAATGTTGGCTCCTACGGTGCTAAGGAACG[G/A]
ATGCCCCAAGATGTCGCGTCCAGGTAGTCACGGGACATGGGAGTGAGTCCATTATAGATGTTTTACAAGATAAGCCAGTCGTCCATCCCATGATGAGGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 39.80% | 0.95% | 7.96% | NA |
| All Indica | 2759 | 32.70% | 65.90% | 0.22% | 1.12% | NA |
| All Japonica | 1512 | 75.90% | 0.50% | 2.05% | 21.49% | NA |
| Aus | 269 | 89.60% | 8.60% | 0.00% | 1.86% | NA |
| Indica I | 595 | 15.30% | 80.70% | 0.34% | 3.70% | NA |
| Indica II | 465 | 35.30% | 64.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 39.60% | 60.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 36.40% | 62.20% | 0.51% | 0.89% | NA |
| Temperate Japonica | 767 | 98.70% | 0.30% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 36.50% | 0.60% | 4.96% | 57.94% | NA |
| Japonica Intermediate | 241 | 85.90% | 1.20% | 2.07% | 10.79% | NA |
| VI/Aromatic | 96 | 87.50% | 3.10% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 54.40% | 30.00% | 6.67% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910097490 | C -> DEL | N | N | silent_mutation | Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0910097490 | C -> T | LOC_Os09g16470.1 | upstream_gene_variant ; 4288.0bp to feature; MODIFIER | silent_mutation | Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0910097490 | C -> T | LOC_Os09g16490.1 | upstream_gene_variant ; 1078.0bp to feature; MODIFIER | silent_mutation | Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0910097490 | C -> T | LOC_Os09g16480.1 | downstream_gene_variant ; 63.0bp to feature; MODIFIER | silent_mutation | Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0910097490 | C -> T | LOC_Os09g16480-LOC_Os09g16490 | intergenic_region ; MODIFIER | silent_mutation | Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910097490 | NA | 7.20E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | 2.24E-06 | 1.42E-06 | mr1215 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 3.56E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 5.00E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 9.19E-08 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 9.50E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 7.40E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 4.26E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 7.43E-09 | mr1498_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 7.82E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910097490 | NA | 1.73E-08 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |