\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910097490:

Variant ID: vg0910097490 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10097490
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCTCATCATGGGATGGACGACTGGCTTATCTTGTAAAACATCTATAATGGACTCACTCCCATGTCCCGTGACTACCTGGACGCGACATCTTGGGGCAT[C/T]
CGTTCCTTAGCACCGTAGGAGCCAACATTGACGTGGGAACGGGGAGTATCCGTTTCCATATTAACGGGAAGGAAGAAAAGTTTGAGTGTCAGAATCAAGT

Reverse complement sequence

ACTTGATTCTGACACTCAAACTTTTCTTCCTTCCCGTTAATATGGAAACGGATACTCCCCGTTCCCACGTCAATGTTGGCTCCTACGGTGCTAAGGAACG[G/A]
ATGCCCCAAGATGTCGCGTCCAGGTAGTCACGGGACATGGGAGTGAGTCCATTATAGATGTTTTACAAGATAAGCCAGTCGTCCATCCCATGATGAGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 39.80% 0.95% 7.96% NA
All Indica  2759 32.70% 65.90% 0.22% 1.12% NA
All Japonica  1512 75.90% 0.50% 2.05% 21.49% NA
Aus  269 89.60% 8.60% 0.00% 1.86% NA
Indica I  595 15.30% 80.70% 0.34% 3.70% NA
Indica II  465 35.30% 64.50% 0.00% 0.22% NA
Indica III  913 39.60% 60.20% 0.00% 0.11% NA
Indica Intermediate  786 36.40% 62.20% 0.51% 0.89% NA
Temperate Japonica  767 98.70% 0.30% 0.13% 0.91% NA
Tropical Japonica  504 36.50% 0.60% 4.96% 57.94% NA
Japonica Intermediate  241 85.90% 1.20% 2.07% 10.79% NA
VI/Aromatic  96 87.50% 3.10% 2.08% 7.29% NA
Intermediate  90 54.40% 30.00% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910097490 C -> DEL N N silent_mutation Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0910097490 C -> T LOC_Os09g16470.1 upstream_gene_variant ; 4288.0bp to feature; MODIFIER silent_mutation Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0910097490 C -> T LOC_Os09g16490.1 upstream_gene_variant ; 1078.0bp to feature; MODIFIER silent_mutation Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0910097490 C -> T LOC_Os09g16480.1 downstream_gene_variant ; 63.0bp to feature; MODIFIER silent_mutation Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0910097490 C -> T LOC_Os09g16480-LOC_Os09g16490 intergenic_region ; MODIFIER silent_mutation Average:52.993; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910097490 NA 7.20E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 2.24E-06 1.42E-06 mr1215 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 3.56E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 5.00E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 9.19E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 9.50E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 7.40E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 4.26E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 7.43E-09 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 7.82E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910097490 NA 1.73E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251