Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910064812:

Variant ID: vg0910064812 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10064812
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGCTGTCACCAGCCGTTGATTGGGGACGGTCAAACCCTCCCGTACTAGGCCGATGCGGCTGCGATGGGCGGGCCAACTCCGTGCCACCGAGTTGCGTT[A/T]
GCCGTAGACCAGGTCGATGCCTTATGGGCCAGCCTGGTAGCCCACACAGGTAGTGGCCCACCTCATTCTTCCACCTTTCCAAGTCCACTATCTCTCCCTC

Reverse complement sequence

GAGGGAGAGATAGTGGACTTGGAAAGGTGGAAGAATGAGGTGGGCCACTACCTGTGTGGGCTACCAGGCTGGCCCATAAGGCATCGACCTGGTCTACGGC[T/A]
AACGCAACTCGGTGGCACGGAGTTGGCCCGCCCATCGCAGCCGCATCGGCCTAGTACGGGAGGGTTTGACCGTCCCCAATCAACGGCTGGTGACAGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.50%	13.80%	0.08%	62.65%	NA
All Indica	2759	4.00%	3.20%	0.11%	92.68%	NA
All Japonica	1512	60.70%	30.20%	0.00%	9.13%	NA
Aus	269	12.30%	15.60%	0.00%	72.12%	NA
Indica I	595	8.20%	4.70%	0.34%	86.72%	NA
Indica II	465	1.90%	6.90%	0.00%	91.18%	NA
Indica III	913	1.00%	1.40%	0.00%	97.59%	NA
Indica Intermediate	786	5.60%	1.90%	0.13%	92.37%	NA
Temperate Japonica	767	93.00%	1.60%	0.00%	5.48%	NA
Tropical Japonica	504	6.90%	80.20%	0.00%	12.90%	NA
Japonica Intermediate	241	70.50%	16.60%	0.00%	12.86%	NA
VI/Aromatic	96	31.20%	32.30%	1.04%	35.42%	NA
Intermediate	90	18.90%	38.90%	0.00%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910064812	A -> DEL	N	N	silent_mutation	Average:22.343; most accessible tissue: Callus, score: 99.794	N	N	N	N
vg0910064812	A -> T	LOC_Os09g16449.1	downstream_gene_variant ; 1752.0bp to feature; MODIFIER	silent_mutation	Average:22.343; most accessible tissue: Callus, score: 99.794	N	N	N	N
vg0910064812	A -> T	LOC_Os09g16449.3	downstream_gene_variant ; 1668.0bp to feature; MODIFIER	silent_mutation	Average:22.343; most accessible tissue: Callus, score: 99.794	N	N	N	N
vg0910064812	A -> T	LOC_Os09g16449.2	downstream_gene_variant ; 1751.0bp to feature; MODIFIER	silent_mutation	Average:22.343; most accessible tissue: Callus, score: 99.794	N	N	N	N
vg0910064812	A -> T	LOC_Os09g16440-LOC_Os09g16449	intergenic_region ; MODIFIER	silent_mutation	Average:22.343; most accessible tissue: Callus, score: 99.794	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910064812	NA	3.36E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	9.98E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.07E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.53E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	8.04E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.94E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.16E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	7.21E-06	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	4.06E-06	NA	mr1223_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	1.91E-08	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	1.32E-06	3.43E-07	mr1308_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	3.17E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.82E-07	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	9.66E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	9.18E-07	4.10E-06	mr1711_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.71E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	5.59E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	2.95E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910064812	NA	1.50E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251