Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910063987:

Variant ID: vg0910063987 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10063987
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGTTTTTAAATCTTAACTTGAAAATTTTTAAATCTGATTTGAAAGTATTCAAATCTCGAGCTGAAAGTTTTCGAATCTGAGTTGAAAGTTTTCGAATC[G/A]
GAGTCGGAAGTTTTCAAATCTAGAGTTGAAAGTTGTCAAATTTTGGGTTGAAAGTTTTCAAATCTAGTTTGAAAGTTTCCAAATCTTGGGTTGAAAGTTT

Reverse complement sequence

AAACTTTCAACCCAAGATTTGGAAACTTTCAAACTAGATTTGAAAACTTTCAACCCAAAATTTGACAACTTTCAACTCTAGATTTGAAAACTTCCGACTC[C/T]
GATTCGAAAACTTTCAACTCAGATTCGAAAACTTTCAGCTCGAGATTTGAATACTTTCAAATCAGATTTAAAAATTTTCAAGTTAAGATTTAAAAACTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.10%	1.40%	20.36%	43.08%	NA
All Indica	2759	5.30%	2.40%	34.11%	58.21%	NA
All Japonica	1512	89.80%	0.10%	0.26%	9.85%	NA
Aus	269	17.50%	0.00%	0.37%	82.16%	NA
Indica I	595	12.60%	2.00%	36.47%	48.91%	NA
Indica II	465	2.20%	3.20%	47.10%	47.53%	NA
Indica III	913	1.80%	1.90%	26.83%	69.55%	NA
Indica Intermediate	786	5.70%	2.80%	33.08%	58.40%	NA
Temperate Japonica	767	94.70%	0.00%	0.13%	5.22%	NA
Tropical Japonica	504	84.10%	0.20%	0.40%	15.28%	NA
Japonica Intermediate	241	86.30%	0.00%	0.41%	13.28%	NA
VI/Aromatic	96	63.50%	0.00%	2.08%	34.38%	NA
Intermediate	90	53.30%	1.10%	15.56%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910063987	G -> DEL	N	N	silent_mutation	Average:27.41; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063987	G -> A	LOC_Os09g16449.1	downstream_gene_variant ; 2577.0bp to feature; MODIFIER	silent_mutation	Average:27.41; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063987	G -> A	LOC_Os09g16449.3	downstream_gene_variant ; 2493.0bp to feature; MODIFIER	silent_mutation	Average:27.41; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063987	G -> A	LOC_Os09g16449.2	downstream_gene_variant ; 2576.0bp to feature; MODIFIER	silent_mutation	Average:27.41; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063987	G -> A	LOC_Os09g16440-LOC_Os09g16449	intergenic_region ; MODIFIER	silent_mutation	Average:27.41; most accessible tissue: Callus, score: 54.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910063987	NA	1.26E-08	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	NA	6.86E-08	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	NA	6.61E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	6.72E-06	3.00E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	3.44E-06	1.85E-09	mr1052	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	NA	3.84E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	4.61E-07	5.04E-11	mr1006_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	NA	1.43E-07	mr1013_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	NA	4.49E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987	NA	1.55E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251