\
| Variant ID: vg0910063987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10063987 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )
AAAGTTTTTAAATCTTAACTTGAAAATTTTTAAATCTGATTTGAAAGTATTCAAATCTCGAGCTGAAAGTTTTCGAATCTGAGTTGAAAGTTTTCGAATC[G/A]
GAGTCGGAAGTTTTCAAATCTAGAGTTGAAAGTTGTCAAATTTTGGGTTGAAAGTTTTCAAATCTAGTTTGAAAGTTTCCAAATCTTGGGTTGAAAGTTT
AAACTTTCAACCCAAGATTTGGAAACTTTCAAACTAGATTTGAAAACTTTCAACCCAAAATTTGACAACTTTCAACTCTAGATTTGAAAACTTCCGACTC[C/T]
GATTCGAAAACTTTCAACTCAGATTCGAAAACTTTCAGCTCGAGATTTGAATACTTTCAAATCAGATTTAAAAATTTTCAAGTTAAGATTTAAAAACTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 1.40% | 20.36% | 43.08% | NA |
| All Indica | 2759 | 5.30% | 2.40% | 34.11% | 58.21% | NA |
| All Japonica | 1512 | 89.80% | 0.10% | 0.26% | 9.85% | NA |
| Aus | 269 | 17.50% | 0.00% | 0.37% | 82.16% | NA |
| Indica I | 595 | 12.60% | 2.00% | 36.47% | 48.91% | NA |
| Indica II | 465 | 2.20% | 3.20% | 47.10% | 47.53% | NA |
| Indica III | 913 | 1.80% | 1.90% | 26.83% | 69.55% | NA |
| Indica Intermediate | 786 | 5.70% | 2.80% | 33.08% | 58.40% | NA |
| Temperate Japonica | 767 | 94.70% | 0.00% | 0.13% | 5.22% | NA |
| Tropical Japonica | 504 | 84.10% | 0.20% | 0.40% | 15.28% | NA |
| Japonica Intermediate | 241 | 86.30% | 0.00% | 0.41% | 13.28% | NA |
| VI/Aromatic | 96 | 63.50% | 0.00% | 2.08% | 34.38% | NA |
| Intermediate | 90 | 53.30% | 1.10% | 15.56% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910063987 | G -> DEL | N | N | silent_mutation | Average:27.41; most accessible tissue: Callus, score: 54.71 | N | N | N | N |
| vg0910063987 | G -> A | LOC_Os09g16449.1 | downstream_gene_variant ; 2577.0bp to feature; MODIFIER | silent_mutation | Average:27.41; most accessible tissue: Callus, score: 54.71 | N | N | N | N |
| vg0910063987 | G -> A | LOC_Os09g16449.3 | downstream_gene_variant ; 2493.0bp to feature; MODIFIER | silent_mutation | Average:27.41; most accessible tissue: Callus, score: 54.71 | N | N | N | N |
| vg0910063987 | G -> A | LOC_Os09g16449.2 | downstream_gene_variant ; 2576.0bp to feature; MODIFIER | silent_mutation | Average:27.41; most accessible tissue: Callus, score: 54.71 | N | N | N | N |
| vg0910063987 | G -> A | LOC_Os09g16440-LOC_Os09g16449 | intergenic_region ; MODIFIER | silent_mutation | Average:27.41; most accessible tissue: Callus, score: 54.71 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910063987 | NA | 1.26E-08 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | NA | 6.86E-08 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | NA | 6.61E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | 6.72E-06 | 3.00E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | 3.44E-06 | 1.85E-09 | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | NA | 3.84E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | 4.61E-07 | 5.04E-11 | mr1006_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | NA | 1.43E-07 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | NA | 4.49E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910063987 | NA | 1.55E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |