\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910063987:

Variant ID: vg0910063987 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10063987
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTTTTAAATCTTAACTTGAAAATTTTTAAATCTGATTTGAAAGTATTCAAATCTCGAGCTGAAAGTTTTCGAATCTGAGTTGAAAGTTTTCGAATC[G/A]
GAGTCGGAAGTTTTCAAATCTAGAGTTGAAAGTTGTCAAATTTTGGGTTGAAAGTTTTCAAATCTAGTTTGAAAGTTTCCAAATCTTGGGTTGAAAGTTT

Reverse complement sequence

AAACTTTCAACCCAAGATTTGGAAACTTTCAAACTAGATTTGAAAACTTTCAACCCAAAATTTGACAACTTTCAACTCTAGATTTGAAAACTTCCGACTC[C/T]
GATTCGAAAACTTTCAACTCAGATTCGAAAACTTTCAGCTCGAGATTTGAATACTTTCAAATCAGATTTAAAAATTTTCAAGTTAAGATTTAAAAACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.10% 1.40% 20.36% 43.08% NA
All Indica  2759 5.30% 2.40% 34.11% 58.21% NA
All Japonica  1512 89.80% 0.10% 0.26% 9.85% NA
Aus  269 17.50% 0.00% 0.37% 82.16% NA
Indica I  595 12.60% 2.00% 36.47% 48.91% NA
Indica II  465 2.20% 3.20% 47.10% 47.53% NA
Indica III  913 1.80% 1.90% 26.83% 69.55% NA
Indica Intermediate  786 5.70% 2.80% 33.08% 58.40% NA
Temperate Japonica  767 94.70% 0.00% 0.13% 5.22% NA
Tropical Japonica  504 84.10% 0.20% 0.40% 15.28% NA
Japonica Intermediate  241 86.30% 0.00% 0.41% 13.28% NA
VI/Aromatic  96 63.50% 0.00% 2.08% 34.38% NA
Intermediate  90 53.30% 1.10% 15.56% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910063987 G -> DEL N N silent_mutation Average:27.41; most accessible tissue: Callus, score: 54.71 N N N N
vg0910063987 G -> A LOC_Os09g16449.1 downstream_gene_variant ; 2577.0bp to feature; MODIFIER silent_mutation Average:27.41; most accessible tissue: Callus, score: 54.71 N N N N
vg0910063987 G -> A LOC_Os09g16449.3 downstream_gene_variant ; 2493.0bp to feature; MODIFIER silent_mutation Average:27.41; most accessible tissue: Callus, score: 54.71 N N N N
vg0910063987 G -> A LOC_Os09g16449.2 downstream_gene_variant ; 2576.0bp to feature; MODIFIER silent_mutation Average:27.41; most accessible tissue: Callus, score: 54.71 N N N N
vg0910063987 G -> A LOC_Os09g16440-LOC_Os09g16449 intergenic_region ; MODIFIER silent_mutation Average:27.41; most accessible tissue: Callus, score: 54.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910063987 NA 1.26E-08 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 NA 6.86E-08 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 NA 6.61E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 6.72E-06 3.00E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 3.44E-06 1.85E-09 mr1052 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 NA 3.84E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 4.61E-07 5.04E-11 mr1006_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 NA 1.43E-07 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 NA 4.49E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063987 NA 1.55E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251