Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0910063949:

Variant ID: vg0910063949 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10063949
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTAGCACACTTATTTTTTCAATATGTTTTGAGATGAAAGTTTTTAAATCTTAACTTGAAAATTTTTAAATCTGATTTGAAAGTATTCAAATCTCGAG[C/T]
TGAAAGTTTTCGAATCTGAGTTGAAAGTTTTCGAATCGGAGTCGGAAGTTTTCAAATCTAGAGTTGAAAGTTGTCAAATTTTGGGTTGAAAGTTTTCAAA

Reverse complement sequence

TTTGAAAACTTTCAACCCAAAATTTGACAACTTTCAACTCTAGATTTGAAAACTTCCGACTCCGATTCGAAAACTTTCAACTCAGATTCGAAAACTTTCA[G/A]
CTCGAGATTTGAATACTTTCAAATCAGATTTAAAAATTTTCAAGTTAAGATTTAAAAACTTTCATCTCAAAACATATTGAAAAAATAAGTGTGCTAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.90%	0.40%	0.89%	62.82%	NA
All Indica	2759	6.30%	0.70%	1.45%	91.55%	NA
All Japonica	1512	90.10%	0.00%	0.07%	9.85%	NA
Aus	269	17.50%	0.00%	0.37%	82.16%	NA
Indica I	595	12.40%	1.50%	2.02%	84.03%	NA
Indica II	465	2.60%	1.10%	3.66%	92.69%	NA
Indica III	913	2.80%	0.10%	0.33%	96.71%	NA
Indica Intermediate	786	7.80%	0.60%	1.02%	90.59%	NA
Temperate Japonica	767	94.70%	0.00%	0.13%	5.22%	NA
Tropical Japonica	504	84.50%	0.00%	0.00%	15.48%	NA
Japonica Intermediate	241	87.10%	0.00%	0.00%	12.86%	NA
VI/Aromatic	96	64.60%	0.00%	0.00%	35.42%	NA
Intermediate	90	56.70%	0.00%	0.00%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910063949	C -> DEL	N	N	silent_mutation	Average:27.531; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063949	C -> T	LOC_Os09g16449.1	downstream_gene_variant ; 2615.0bp to feature; MODIFIER	silent_mutation	Average:27.531; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063949	C -> T	LOC_Os09g16449.3	downstream_gene_variant ; 2531.0bp to feature; MODIFIER	silent_mutation	Average:27.531; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063949	C -> T	LOC_Os09g16449.2	downstream_gene_variant ; 2614.0bp to feature; MODIFIER	silent_mutation	Average:27.531; most accessible tissue: Callus, score: 54.71	N	N	N	N
vg0910063949	C -> T	LOC_Os09g16440-LOC_Os09g16449	intergenic_region ; MODIFIER	silent_mutation	Average:27.531; most accessible tissue: Callus, score: 54.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910063949	NA	1.03E-07	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	NA	8.37E-07	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	4.81E-06	2.22E-06	mr1037	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	NA	2.88E-08	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	NA	2.61E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	NA	1.06E-08	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	9.42E-06	9.42E-06	mr1293_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	NA	4.66E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	NA	8.25E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910063949	4.44E-06	4.44E-06	mr1899_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251