\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910053330:

Variant ID: vg0910053330 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10053330
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGGTTTCAACTTTCAGATAATCCAAAAAATATCATTGACAAGCGTCCAAATCCCAGAAATACCATCGACAAGGGTGAGTTCCAAGAAATACCATCGTA[C/T]
AAATGACTTTGTCCCAAAAATGCCATTTCCGTTAGAGTTCCATCCATTCCACGCCGTTAAGTTCTATAAGATAAATAGTGTATTTAACGGCACAAAATTG

Reverse complement sequence

CAATTTTGTGCCGTTAAATACACTATTTATCTTATAGAACTTAACGGCGTGGAATGGATGGAACTCTAACGGAAATGGCATTTTTGGGACAAAGTCATTT[G/A]
TACGATGGTATTTCTTGGAACTCACCCTTGTCGATGGTATTTCTGGGATTTGGACGCTTGTCAATGATATTTTTTGGATTATCTGAAAGTTGAAACCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.70% 11.70% 22.96% 28.65% NA
All Indica  2759 22.30% 1.80% 34.51% 41.39% NA
All Japonica  1512 62.90% 28.80% 1.59% 6.68% NA
Aus  269 40.10% 4.50% 29.00% 26.39% NA
Indica I  595 16.10% 4.50% 43.70% 35.63% NA
Indica II  465 14.00% 0.60% 36.13% 49.25% NA
Indica III  913 29.80% 1.10% 27.38% 41.73% NA
Indica Intermediate  786 23.20% 1.30% 34.86% 40.71% NA
Temperate Japonica  767 93.10% 1.60% 1.43% 3.91% NA
Tropical Japonica  504 12.70% 76.80% 1.79% 8.73% NA
Japonica Intermediate  241 71.80% 15.40% 1.66% 11.20% NA
VI/Aromatic  96 32.30% 26.00% 15.62% 26.04% NA
Intermediate  90 33.30% 32.20% 17.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910053330 C -> DEL N N silent_mutation Average:10.644; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0910053330 C -> T LOC_Os09g16430.1 upstream_gene_variant ; 3965.0bp to feature; MODIFIER silent_mutation Average:10.644; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0910053330 C -> T LOC_Os09g16440.1 intron_variant ; MODIFIER silent_mutation Average:10.644; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910053330 NA 4.68E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 6.84E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 5.90E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 6.42E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 7.07E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 1.51E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 8.22E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 4.52E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 4.73E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 9.67E-09 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 1.44E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 1.53E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 8.61E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 3.97E-07 NA mr1699_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 2.80E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910053330 NA 2.46E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251