\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910045544:

Variant ID: vg0910045544 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10045544
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGTGCGTTGGTGAGTCCAAAAGACATAACTGTGCATTCGAACAACCCATAATGACTGATGAATGCTATCTTTGGAATACCTCTTCGCTGATCGTCAACT[A/G]
GTGATAGCCTGATCGCAGGTCTATCTTAGAGAACACCGTAGCTCCTTTCAACTGATCAAACAGATCATCAATTCTTGGCAACGGATACTTGTTCTTAATA

Reverse complement sequence

TATTAAGAACAAGTATCCGTTGCCAAGAATTGATGATCTGTTTGATCAGTTGAAAGGAGCTACGGTGTTCTCTAAGATAGACCTGCGATCAGGCTATCAC[T/C]
AGTTGACGATCAGCGAAGAGGTATTCCAAAGATAGCATTCATCAGTCATTATGGGTTGTTCGAATGCACAGTTATGTCTTTTGGACTCACCAACGCACCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.60% 11.90% 0.76% 63.73% NA
All Indica  2759 4.00% 2.00% 1.12% 92.93% NA
All Japonica  1512 60.90% 28.70% 0.00% 10.38% NA
Aus  269 13.40% 4.10% 0.74% 81.78% NA
Indica I  595 8.20% 4.70% 1.18% 85.88% NA
Indica II  465 1.90% 0.60% 1.72% 95.70% NA
Indica III  913 0.90% 1.40% 0.99% 96.71% NA
Indica Intermediate  786 5.50% 1.40% 0.89% 92.24% NA
Temperate Japonica  767 93.20% 1.40% 0.00% 5.35% NA
Tropical Japonica  504 7.10% 76.80% 0.00% 16.07% NA
Japonica Intermediate  241 70.50% 14.90% 0.00% 14.52% NA
VI/Aromatic  96 31.20% 32.30% 0.00% 36.46% NA
Intermediate  90 23.30% 33.30% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910045544 A -> G LOC_Os09g16420.1 downstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:10.173; most accessible tissue: Callus, score: 47.256 N N N N
vg0910045544 A -> G LOC_Os09g16430.1 intron_variant ; MODIFIER silent_mutation Average:10.173; most accessible tissue: Callus, score: 47.256 N N N N
vg0910045544 A -> DEL N N silent_mutation Average:10.173; most accessible tissue: Callus, score: 47.256 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910045544 NA 2.85E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.40E-07 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 2.58E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.69E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 6.48E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.79E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 3.92E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 2.51E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.48E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 3.77E-06 3.76E-06 mr1978 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 7.37E-07 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 6.54E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 3.47E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 3.55E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 6.56E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 1.06E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 2.33E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 3.49E-06 NA mr1291_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 3.09E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.59E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 1.82E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 8.26E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 5.59E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.64E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 4.67E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 1.77E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 1.08E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 1.75E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 6.93E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045544 NA 6.51E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251