\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910045511:

Variant ID: vg0910045511 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10045511
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACACCTTGTTCATCAAATTCATGAAGAAGGCAGGTGCGTTGGTGAGTCCAAAAGACATAACTGTGCATTCGAACAACCCATAATGACTGATGAATGCT[A/G]
TCTTTGGAATACCTCTTCGCTGATCGTCAACTAGTGATAGCCTGATCGCAGGTCTATCTTAGAGAACACCGTAGCTCCTTTCAACTGATCAAACAGATCA

Reverse complement sequence

TGATCTGTTTGATCAGTTGAAAGGAGCTACGGTGTTCTCTAAGATAGACCTGCGATCAGGCTATCACTAGTTGACGATCAGCGAAGAGGTATTCCAAAGA[T/C]
AGCATTCATCAGTCATTATGGGTTGTTCGAATGCACAGTTATGTCTTTTGGACTCACCAACGCACCTGCCTTCTTCATGAATTTGATGAACAAGGTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.60% 11.90% 0.53% 63.99% NA
All Indica  2759 4.00% 1.90% 0.83% 93.29% NA
All Japonica  1512 60.80% 28.70% 0.00% 10.45% NA
Aus  269 13.00% 5.20% 0.00% 81.78% NA
Indica I  595 8.40% 4.50% 0.84% 86.22% NA
Indica II  465 1.70% 0.60% 1.51% 96.13% NA
Indica III  913 1.00% 1.30% 0.66% 97.04% NA
Indica Intermediate  786 5.30% 1.40% 0.64% 92.62% NA
Temperate Japonica  767 93.10% 1.40% 0.00% 5.48% NA
Tropical Japonica  504 7.10% 76.80% 0.00% 16.07% NA
Japonica Intermediate  241 70.50% 14.90% 0.00% 14.52% NA
VI/Aromatic  96 31.20% 32.30% 0.00% 36.46% NA
Intermediate  90 23.30% 33.30% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910045511 A -> G LOC_Os09g16420.1 downstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:10.242; most accessible tissue: Callus, score: 47.256 N N N N
vg0910045511 A -> G LOC_Os09g16430.1 intron_variant ; MODIFIER silent_mutation Average:10.242; most accessible tissue: Callus, score: 47.256 N N N N
vg0910045511 A -> DEL N N silent_mutation Average:10.242; most accessible tissue: Callus, score: 47.256 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910045511 NA 8.03E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 1.09E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 4.64E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 9.24E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 4.62E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 7.47E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 1.23E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 9.28E-10 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 9.41E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 5.73E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 5.05E-10 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 2.07E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 5.19E-12 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 4.35E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 1.20E-11 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 7.30E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 9.49E-07 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 2.71E-06 NA mr1798_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 2.55E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 8.45E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910045511 NA 8.24E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251