RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0910031361:

Variant ID: vg0910031361 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10031361
Reference Allele: A	Alternative Allele: C,T
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, A: 0.34, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGAACTATATTTTTTGGGAGTTACCATATTGGGAATTTTTGGACGTCCGCCACGCAATCGACGTGATGCACCTCACTAAGAACCTTTGCGTAAATCTG[A/C,T]
TGGGCTTTTAAGGTGTATATGGGAAGTCGAAAGATACACTGGAAGCACGTAATGATATGAAGCATATGGAACAACGCGGCGACCTTCACCTAGAACCAAA

Reverse complement sequence

TTTGGTTCTAGGTGAAGGTCGCCGCGTTGTTCCATATGCTTCATATCATTACGTGCTTCCAGTGTATCTTTCGACTTCCCATATACACCTTAAAAGCCCA[T/G,A]
CAGATTTACGCAAAGGTTCTTAGTGAGGTGCATCACGTCGATTGCGTGGCGGACGTCCAAAAATTCCCAATATGGTAACTCCCAAAAAATATAGTTCTTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.50%	18.80%	22.07%	34.30%	T: 0.25%
All Indica	2759	5.40%	12.00%	30.84%	51.65%	T: 0.11%
All Japonica	1512	60.80%	30.00%	4.30%	4.50%	T: 0.40%
Aus	269	16.00%	12.30%	31.97%	39.78%	NA
Indica I	595	11.40%	8.70%	27.39%	52.44%	NA
Indica II	465	3.70%	7.50%	28.39%	60.43%	NA
Indica III	913	0.90%	18.20%	36.25%	44.47%	T: 0.22%
Indica Intermediate	786	7.30%	9.80%	28.63%	54.20%	T: 0.13%
Temperate Japonica	767	93.20%	2.20%	2.87%	1.69%	NA
Tropical Japonica	504	7.10%	77.80%	6.55%	7.34%	T: 1.19%
Japonica Intermediate	241	70.10%	18.30%	4.15%	7.47%	NA
VI/Aromatic	96	27.10%	39.60%	23.96%	6.25%	T: 3.12%
Intermediate	90	23.30%	40.00%	20.00%	16.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910031361	A -> DEL	LOC_Os09g16400.1	N	frameshift_variant	Average:9.437; most accessible tissue: Callus, score: 16.407	N	N	N	N
vg0910031361	A -> T	LOC_Os09g16400.1	missense_variant ; p.Met333Leu; MODERATE	nonsynonymous_codon ; M333L	Average:9.437; most accessible tissue: Callus, score: 16.407	probably damaging	-2.362	TOLERATED	1.00
vg0910031361	A -> C	LOC_Os09g16400.1	missense_variant ; p.Met333Leu; MODERATE	nonsynonymous_codon ; M333L	Average:9.437; most accessible tissue: Callus, score: 16.407	probably damaging	-2.362	TOLERATED	1.00

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910031361	3.60E-06	4.56E-08	mr1029	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	9.30E-06	1.15E-08	mr1047	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	6.48E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	9.13E-07	9.13E-07	mr1189	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	1.09E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	4.86E-07	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	7.81E-09	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	1.53E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	2.17E-14	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910031361	NA	4.43E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 28 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0910031361:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact