\
| Variant ID: vg0910028393 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10028393 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 322. )
ATCAATGGCTCGAGTAACCATGTTTCAGAAACAGGTATTTGCCCTCTTGAGACCTGCTTCTTTGCTGGTACTTTGTTTCCAATCTACTTACACAATTTGT[C/T]
TGTATAGCTGTATAATTGATCATTCTTTCGTACACCCTGCATACTTACGTACATATGTTATTCCTCCAAATATCTGATTGATTGATACGTGATACAATGT
ACATTGTATCACGTATCAATCAATCAGATATTTGGAGGAATAACATATGTACGTAAGTATGCAGGGTGTACGAAAGAATGATCAATTATACAGCTATACA[G/A]
ACAAATTGTGTAAGTAGATTGGAAACAAAGTACCAGCAAAGAAGCAGGTCTCAAGAGGGCAAATACCTGTTTCTGAAACATGGTTACTCGAGCCATTGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 12.00% | 2.07% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 0.70% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 60.10% | 35.80% | 4.10% | 0.00% | NA |
| Aus | 269 | 98.10% | 0.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 95.10% | 2.20% | 2.69% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 0.60% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 30.00% | 63.40% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 21.20% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910028393 | C -> T | LOC_Os09g16390.1 | downstream_gene_variant ; 4514.0bp to feature; MODIFIER | silent_mutation | Average:55.405; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0910028393 | C -> T | LOC_Os09g16400.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.405; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910028393 | NA | 5.56E-22 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | 4.45E-09 | 2.85E-37 | mr1137 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | NA | 1.07E-13 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | NA | 2.57E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | 3.34E-08 | 1.07E-31 | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | NA | 5.96E-12 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | NA | 5.25E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | 8.73E-07 | 3.82E-36 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | NA | 1.97E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910028393 | NA | 1.36E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |