Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910028393:

Variant ID: vg0910028393 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 10028393
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

ATCAATGGCTCGAGTAACCATGTTTCAGAAACAGGTATTTGCCCTCTTGAGACCTGCTTCTTTGCTGGTACTTTGTTTCCAATCTACTTACACAATTTGT[C/T]
TGTATAGCTGTATAATTGATCATTCTTTCGTACACCCTGCATACTTACGTACATATGTTATTCCTCCAAATATCTGATTGATTGATACGTGATACAATGT

Reverse complement sequence

ACATTGTATCACGTATCAATCAATCAGATATTTGGAGGAATAACATATGTACGTAAGTATGCAGGGTGTACGAAAGAATGATCAATTATACAGCTATACA[G/A]
ACAAATTGTGTAAGTAGATTGGAAACAAAGTACCAGCAAAGAAGCAGGTCTCAAGAGGGCAAATACCTGTTTCTGAAACATGGTTACTCGAGCCATTGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.90%	12.00%	2.07%	0.00%	NA
All Indica	2759	98.30%	0.70%	1.01%	0.00%	NA
All Japonica	1512	60.10%	35.80%	4.10%	0.00%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	95.10%	2.20%	2.69%	0.00%	NA
Indica II	465	98.90%	0.00%	1.08%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	0.60%	0.89%	0.00%	NA
Temperate Japonica	767	30.00%	63.40%	6.65%	0.00%	NA
Tropical Japonica	504	98.80%	0.80%	0.40%	0.00%	NA
Japonica Intermediate	241	75.10%	21.20%	3.73%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	7.80%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0910028393	C -> T	LOC_Os09g16390.1	downstream_gene_variant ; 4514.0bp to feature; MODIFIER	silent_mutation	Average:55.405; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg0910028393	C -> T	LOC_Os09g16400.1	intron_variant ; MODIFIER	silent_mutation	Average:55.405; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0910028393	NA	5.56E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	4.45E-09	2.85E-37	mr1137	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	NA	1.07E-13	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	NA	2.57E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	3.34E-08	1.07E-31	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	NA	5.96E-12	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	NA	5.25E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	8.73E-07	3.82E-36	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	NA	1.97E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393	NA	1.36E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251