\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0910028393:

Variant ID: vg0910028393 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 10028393
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


ATCAATGGCTCGAGTAACCATGTTTCAGAAACAGGTATTTGCCCTCTTGAGACCTGCTTCTTTGCTGGTACTTTGTTTCCAATCTACTTACACAATTTGT[C/T]
TGTATAGCTGTATAATTGATCATTCTTTCGTACACCCTGCATACTTACGTACATATGTTATTCCTCCAAATATCTGATTGATTGATACGTGATACAATGT

Reverse complement sequence

ACATTGTATCACGTATCAATCAATCAGATATTTGGAGGAATAACATATGTACGTAAGTATGCAGGGTGTACGAAAGAATGATCAATTATACAGCTATACA[G/A]
ACAAATTGTGTAAGTAGATTGGAAACAAAGTACCAGCAAAGAAGCAGGTCTCAAGAGGGCAAATACCTGTTTCTGAAACATGGTTACTCGAGCCATTGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 12.00% 2.07% 0.00% NA
All Indica  2759 98.30% 0.70% 1.01% 0.00% NA
All Japonica  1512 60.10% 35.80% 4.10% 0.00% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 95.10% 2.20% 2.69% 0.00% NA
Indica II  465 98.90% 0.00% 1.08% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.60% 0.89% 0.00% NA
Temperate Japonica  767 30.00% 63.40% 6.65% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 75.10% 21.20% 3.73% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 87.80% 7.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0910028393 C -> T LOC_Os09g16390.1 downstream_gene_variant ; 4514.0bp to feature; MODIFIER silent_mutation Average:55.405; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0910028393 C -> T LOC_Os09g16400.1 intron_variant ; MODIFIER silent_mutation Average:55.405; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0910028393 NA 5.56E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 4.45E-09 2.85E-37 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 NA 1.07E-13 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 NA 2.57E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 3.34E-08 1.07E-31 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 NA 5.96E-12 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 NA 5.25E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 8.73E-07 3.82E-36 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 NA 1.97E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0910028393 NA 1.36E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251