\
| Variant ID: vg0910004814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 10004814 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.24, others allele: 0.00, population size: 82. )
ACCGGGGTGAGTCCATTGTAAAAATTCTGCAGGATTAGCCAGTCGTCCATCCCATGATGAGGACAGGCGGCCACGTACTCCTGCAGTTGTTCCCATGCTT[T/C]
CGGAATAGACTCATCCCTTATCTGCTAGAAACTTGAAATCCTTCCATAAAGGGCATTGGTTTTGCCCATCGGGAAGAATTTTGAGAGGAATGCCATCAAG
CTTGATGGCATTCCTCTCAAAATTCTTCCCGATGGGCAAAACCAATGCCCTTTATGGAAGGATTTCAAGTTTCTAGCAGATAAGGGATGAGTCTATTCCG[A/G]
AAGCATGGGAACAACTGCAGGAGTACGTGGCCGCCTGTCCTCATCATGGGATGGACGACTGGCTAATCCTGCAGAATTTTTACAATGGACTCACCCCGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.30% | 4.40% | 4.00% | 67.35% | NA |
| All Indica | 2759 | 5.00% | 5.00% | 4.24% | 85.79% | NA |
| All Japonica | 1512 | 61.80% | 2.10% | 3.51% | 32.54% | NA |
| Aus | 269 | 13.00% | 4.50% | 3.72% | 78.81% | NA |
| Indica I | 595 | 10.90% | 1.50% | 4.54% | 83.03% | NA |
| Indica II | 465 | 3.20% | 2.40% | 3.01% | 91.40% | NA |
| Indica III | 913 | 0.40% | 9.20% | 5.04% | 85.32% | NA |
| Indica Intermediate | 786 | 6.70% | 4.30% | 3.82% | 85.11% | NA |
| Temperate Japonica | 767 | 94.50% | 0.00% | 0.13% | 5.35% | NA |
| Tropical Japonica | 504 | 7.70% | 5.80% | 9.33% | 77.18% | NA |
| Japonica Intermediate | 241 | 71.00% | 1.20% | 2.07% | 25.73% | NA |
| VI/Aromatic | 96 | 21.90% | 18.80% | 3.12% | 56.25% | NA |
| Intermediate | 90 | 22.20% | 6.70% | 6.67% | 64.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0910004814 | T -> DEL | N | N | silent_mutation | Average:16.608; most accessible tissue: Callus, score: 33.189 | N | N | N | N |
| vg0910004814 | T -> C | LOC_Os09g16380.1 | downstream_gene_variant ; 4024.0bp to feature; MODIFIER | silent_mutation | Average:16.608; most accessible tissue: Callus, score: 33.189 | N | N | N | N |
| vg0910004814 | T -> C | LOC_Os09g16370.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.608; most accessible tissue: Callus, score: 33.189 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0910004814 | NA | 4.89E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | 1.23E-06 | 1.23E-06 | mr1370 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 5.52E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 5.09E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 3.08E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 1.67E-20 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 6.98E-10 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 2.94E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 8.98E-22 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 7.17E-09 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0910004814 | NA | 7.91E-17 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |