\
| Variant ID: vg0909993670 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9993670 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )
AGTCTCGCCAAAGAAAGGGGTCTCGTTGAATCAGATTGAGACGGAAATCCCAGTGGACACCGTAGAGAAGAACTTGAGAAAATTGGAAGATATACCCATA[A/G]
TCTGCGAGTATCCAGAAGTGTTCCCCGAAGACCTCACTACCATGCCACCCAAGAGAGAGATTGAATTCCGGATTGACTTGGCACCGGGAACTGCTCCAAT
ATTGGAGCAGTTCCCGGTGCCAAGTCAATCCGGAATTCAATCTCTCTCTTGGGTGGCATGGTAGTGAGGTCTTCGGGGAACACTTCTGGATACTCGCAGA[T/C]
TATGGGTATATCTTCCAATTTTCTCAAGTTCTTCTCTACGGTGTCCACTGGGATTTCCGTCTCAATCTGATTCAACGAGACCCCTTTCTTTGGCGAGACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.50% | 25.00% | 1.10% | 0.44% | NA |
| All Indica | 2759 | 93.90% | 5.20% | 0.87% | 0.00% | NA |
| All Japonica | 1512 | 34.10% | 63.20% | 1.39% | 1.39% | NA |
| Aus | 269 | 85.50% | 13.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 84.40% | 13.80% | 1.85% | 0.00% | NA |
| Indica II | 465 | 94.20% | 4.50% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 4.70% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 4.70% | 94.50% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 84.50% | 10.30% | 1.98% | 3.17% | NA |
| Japonica Intermediate | 241 | 22.00% | 73.90% | 2.49% | 1.66% | NA |
| VI/Aromatic | 96 | 75.00% | 22.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909993670 | A -> G | LOC_Os09g16350.1 | missense_variant ; p.Ile552Val; MODERATE | nonsynonymous_codon ; I552V | Average:20.783; most accessible tissue: Minghui63 flower, score: 32.19 | unknown | unknown | TOLERATED | 1.00 |
| vg0909993670 | A -> DEL | LOC_Os09g16350.1 | N | frameshift_variant | Average:20.783; most accessible tissue: Minghui63 flower, score: 32.19 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909993670 | NA | 9.28E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 7.35E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 4.26E-08 | mr1425 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 1.66E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 2.15E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 6.38E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 3.97E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 2.10E-20 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 1.17E-08 | mr1679 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 9.93E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 8.08E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 1.64E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 1.33E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 5.41E-17 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 1.82E-22 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909993670 | NA | 3.57E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |