\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909958821:

Variant ID: vg0909958821 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9958821
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGTGGTTTTCTAAGTACAAATAAGTTTTCACATATGGTCTATGAACTTAAAAGCGACCTCCGCCATCTTTCTAGCTGGTTTTTCTTTTAGGCCACAT[G/A]
TGAAAAGAAAAAGTCTCGTGCGTTGCGAAAATCATTTTTTAAGTAGTGCAGGTCCTCCACTACGAGTCTACTCCTTGCTGCATATAGTTTGTGAAGGCGA

Reverse complement sequence

TCGCCTTCACAAACTATATGCAGCAAGGAGTAGACTCGTAGTGGAGGACCTGCACTACTTAAAAAATGATTTTCGCAACGCACGAGACTTTTTCTTTTCA[C/T]
ATGTGGCCTAAAAGAAAAACCAGCTAGAAAGATGGCGGAGGTCGCTTTTAAGTTCATAGACCATATGTGAAAACTTATTTGTACTTAGAAAACCACCTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 13.20% 0.21% 0.00% NA
All Indica  2759 93.70% 6.10% 0.22% 0.00% NA
All Japonica  1512 72.90% 27.10% 0.07% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 84.30% 15.10% 0.65% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 91.90% 7.90% 0.25% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 26.80% 73.00% 0.20% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 75.60% 21.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909958821 G -> A LOC_Os09g16300.1 intron_variant ; MODIFIER silent_mutation Average:73.593; most accessible tissue: Zhenshan97 flower, score: 92.866 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909958821 G A -0.01 0.0 0.01 -0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909958821 NA 1.15E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 4.04E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 7.25E-07 1.93E-07 mr1208 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 9.45E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 3.30E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 1.41E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 6.10E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 8.10E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 8.09E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 5.12E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 2.46E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 1.52E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 1.16E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 3.39E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 3.66E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 2.94E-08 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 1.52E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 2.64E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 6.27E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 1.23E-06 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 3.00E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 1.93E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 6.10E-07 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909958821 NA 2.98E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251