Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909930571:

Variant ID: vg0909930571 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9930571
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTTTAGTCAGGACCCAGATGTTAGTAGCTAATTAAGGGTTGAATTCCATTATCAAATATCAGTTGTTTAGTGTTGTCATGATGCATGTCTTGGTAAAT[C/T]
AATGTCCACATAACTTATCGATGCATTCGAGCCGATCTTTTTTTTTCAATCCTGAAACCTCAATGGTGTTGGTTCCTAAACCGGTGCCTTTCGATTCCCC

Reverse complement sequence

GGGGAATCGAAAGGCACCGGTTTAGGAACCAACACCATTGAGGTTTCAGGATTGAAAAAAAAAGATCGGCTCGAATGCATCGATAAGTTATGTGGACATT[G/A]
ATTTACCAAGACATGCATCATGACAACACTAAACAACTGATATTTGATAATGGAATTCAACCCTTAATTAGCTACTAACATCTGGGTCCTGACTAAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	25.00%	0.04%	0.32%	NA
All Indica	2759	79.90%	19.60%	0.04%	0.47%	NA
All Japonica	1512	67.90%	32.00%	0.07%	0.07%	NA
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	87.40%	12.10%	0.00%	0.50%	NA
Indica II	465	82.60%	16.60%	0.00%	0.86%	NA
Indica III	913	75.40%	24.50%	0.00%	0.11%	NA
Indica Intermediate	786	77.90%	21.40%	0.13%	0.64%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	21.60%	78.00%	0.20%	0.20%	NA
Japonica Intermediate	241	78.00%	22.00%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909930571	C -> DEL	N	N	silent_mutation	Average:63.536; most accessible tissue: Minghui63 flower, score: 80.339	N	N	N	N
vg0909930571	C -> T	LOC_Os09g16260.2	upstream_gene_variant ; 3856.0bp to feature; MODIFIER	silent_mutation	Average:63.536; most accessible tissue: Minghui63 flower, score: 80.339	N	N	N	N
vg0909930571	C -> T	LOC_Os09g16280.1	upstream_gene_variant ; 2704.0bp to feature; MODIFIER	silent_mutation	Average:63.536; most accessible tissue: Minghui63 flower, score: 80.339	N	N	N	N
vg0909930571	C -> T	LOC_Os09g16260.1	upstream_gene_variant ; 3856.0bp to feature; MODIFIER	silent_mutation	Average:63.536; most accessible tissue: Minghui63 flower, score: 80.339	N	N	N	N
vg0909930571	C -> T	LOC_Os09g16270.1	downstream_gene_variant ; 1788.0bp to feature; MODIFIER	silent_mutation	Average:63.536; most accessible tissue: Minghui63 flower, score: 80.339	N	N	N	N
vg0909930571	C -> T	LOC_Os09g16270-LOC_Os09g16280	intergenic_region ; MODIFIER	silent_mutation	Average:63.536; most accessible tissue: Minghui63 flower, score: 80.339	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0909930571	C	T	0.03	0.01	0.01	0.03	0.05	0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909930571	NA	6.48E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	1.68E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	9.19E-07	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	5.55E-06	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	3.97E-07	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	1.19E-06	mr1446	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	4.77E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	2.76E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	2.04E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	9.44E-06	mr1903	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909930571	NA	4.58E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251