\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909926383:

Variant ID: vg0909926383 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9926383
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGGGTTGAAATATATCAACATGGAAAGAGCAACTAAAAATTTATTGGCATAATGAAGAACGAAAAAACTATATATTATTTGGAAGATCTCTTGAACA[G/A]
CAACAAAGATAATTTCTTCTCTTCAGAAAAAAAAATCAATTGGAACAGTCTATAACTTCAGAAAAAAAAAACCATCAACATGATGAACAAATACAAACCC

Reverse complement sequence

GGGTTTGTATTTGTTCATCATGTTGATGGTTTTTTTTTTCTGAAGTTATAGACTGTTCCAATTGATTTTTTTTTCTGAAGAGAAGAAATTATCTTTGTTG[C/T]
TGTTCAAGAGATCTTCCAAATAATATATAGTTTTTTCGTTCTTCATTATGCCAATAAATTTTTAGTTGCTCTTTCCATGTTGATATATTTCAACCCATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 26.40% 10.37% 5.67% NA
All Indica  2759 55.30% 30.90% 8.77% 5.00% NA
All Japonica  1512 67.10% 9.90% 14.81% 8.20% NA
Aus  269 33.10% 66.20% 0.74% 0.00% NA
Indica I  595 80.70% 9.60% 8.40% 1.34% NA
Indica II  465 69.50% 18.30% 6.67% 5.59% NA
Indica III  913 29.60% 53.90% 9.53% 7.01% NA
Indica Intermediate  786 57.80% 27.70% 9.41% 5.09% NA
Temperate Japonica  767 94.90% 0.90% 4.04% 0.13% NA
Tropical Japonica  504 19.60% 25.40% 32.54% 22.42% NA
Japonica Intermediate  241 78.00% 5.80% 12.03% 4.15% NA
VI/Aromatic  96 36.50% 51.00% 8.33% 4.17% NA
Intermediate  90 57.80% 24.40% 15.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909926383 G -> DEL N N silent_mutation Average:24.985; most accessible tissue: Callus, score: 41.981 N N N N
vg0909926383 G -> A LOC_Os09g16270.1 upstream_gene_variant ; 1792.0bp to feature; MODIFIER silent_mutation Average:24.985; most accessible tissue: Callus, score: 41.981 N N N N
vg0909926383 G -> A LOC_Os09g16260.2 intron_variant ; MODIFIER silent_mutation Average:24.985; most accessible tissue: Callus, score: 41.981 N N N N
vg0909926383 G -> A LOC_Os09g16260.1 intron_variant ; MODIFIER silent_mutation Average:24.985; most accessible tissue: Callus, score: 41.981 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909926383 NA 8.60E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 4.25E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 3.20E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 6.62E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 1.13E-08 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 4.21E-06 4.20E-06 mr1736 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 1.63E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 1.56E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 7.07E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 2.86E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 3.61E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 2.85E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 8.36E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 3.27E-18 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909926383 NA 9.04E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251