Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909867986:

Variant ID: vg0909867986 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9867986
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACGGATTGCCGCCACCTCCGCCTCCACTGGGCATAGGTGCGGTGCCTGCACCTCGATCGATCGAGGTGTAGGCACCGCACCTATTGAGCTCTGCCGGTG[A/G]
GCTCGTTCCTCACTACTGGGTGCTCCTCGTAGCTGCCAACACCGTAGCTGCTGTTGGAGACTCCTCTCTACCATTGTTGTCGCTGGATGCCTGGGTATTC

Reverse complement sequence

GAATACCCAGGCATCCAGCGACAACAATGGTAGAGAGGAGTCTCCAACAGCAGCTACGGTGTTGGCAGCTACGAGGAGCACCCAGTAGTGAGGAACGAGC[T/C]
CACCGGCAGAGCTCAATAGGTGCGGTGCCTACACCTCGATCGATCGAGGTGCAGGCACCGCACCTATGCCCAGTGGAGGCGGAGGTGGCGGCAATCCGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.60%	23.20%	0.55%	38.68%	NA
All Indica	2759	39.70%	5.30%	0.72%	54.30%	NA
All Japonica	1512	29.90%	54.10%	0.33%	15.67%	NA
Aus	269	65.40%	10.40%	0.37%	23.79%	NA
Indica I	595	23.40%	0.80%	1.68%	74.12%	NA
Indica II	465	24.70%	10.10%	0.43%	64.73%	NA
Indica III	913	58.90%	6.90%	0.33%	33.84%	NA
Indica Intermediate	786	38.50%	3.90%	0.64%	56.87%	NA
Temperate Japonica	767	3.40%	76.90%	0.52%	19.17%	NA
Tropical Japonica	504	75.80%	10.90%	0.20%	13.10%	NA
Japonica Intermediate	241	18.30%	71.80%	0.00%	9.96%	NA
VI/Aromatic	96	20.80%	76.00%	0.00%	3.12%	NA
Intermediate	90	36.70%	34.40%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909867986	A -> G	LOC_Os09g16180.1	downstream_gene_variant ; 2749.0bp to feature; MODIFIER	silent_mutation	Average:43.088; most accessible tissue: Callus, score: 69.89	N	N	N	N
vg0909867986	A -> G	LOC_Os09g16180-LOC_Os09g16190	intergenic_region ; MODIFIER	silent_mutation	Average:43.088; most accessible tissue: Callus, score: 69.89	N	N	N	N
vg0909867986	A -> DEL	N	N	silent_mutation	Average:43.088; most accessible tissue: Callus, score: 69.89	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909867986	NA	8.20E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	NA	1.30E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	1.52E-06	1.52E-06	mr1916	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	NA	2.58E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	NA	4.13E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	NA	2.98E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	NA	1.06E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909867986	NA	9.63E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251