\
| Variant ID: vg0909829640 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9829640 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCGGACGTTCGGGTGTTTGGCACACGTCAAGACCACCACGCCGAATGTCAAGAAGCTCGACGACAGGAGTAAGCCCATGATCTTTGTGGGTTATGAGCC[G/A]
GGGTCGAAGGCGTATCGCTGCTACGACCCTGCCTCTCGGCGCGTGCACATCTCACGTGACGTCGCATTCGACGAAGAGGCGCAATGGAGGTGGGACGGCG
CGCCGTCCCACCTCCATTGCGCCTCTTCGTCGAATGCGACGTCACGTGAGATGTGCACGCGCCGAGAGGCAGGGTCGTAGCAGCGATACGCCTTCGACCC[C/T]
GGCTCATAACCCACAAAGATCATGGGCTTACTCCTGTCGTCGAGCTTCTTGACATTCGGCGTGGTGGTCTTGACGTGTGCCAAACACCCGAACGTCCGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 4.10% | 0.44% | 4.21% | NA |
| All Indica | 2759 | 97.00% | 0.40% | 0.47% | 2.07% | NA |
| All Japonica | 1512 | 92.60% | 0.00% | 0.07% | 7.34% | NA |
| Aus | 269 | 31.20% | 65.40% | 2.23% | 1.12% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 93.00% | 0.50% | 1.20% | 5.26% | NA |
| Indica Intermediate | 786 | 98.30% | 0.60% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 86.70% | 0.00% | 0.13% | 13.17% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 68.80% | 2.10% | 1.04% | 28.12% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909829640 | G -> DEL | LOC_Os09g16100.1 | N | frameshift_variant | Average:24.097; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0909829640 | G -> A | LOC_Os09g16100.1 | synonymous_variant ; p.Pro750Pro; LOW | synonymous_codon | Average:24.097; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909829640 | NA | 6.21E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 2.92E-10 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 7.34E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 2.91E-24 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 4.97E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 1.33E-11 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | 1.26E-06 | 2.41E-08 | mr1049_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | 1.01E-06 | 7.99E-11 | mr1344_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 2.79E-09 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 1.06E-07 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 3.52E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | 1.68E-06 | 1.31E-07 | mr1704_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 3.56E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | 4.73E-06 | 3.69E-11 | mr1808_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | NA | 4.38E-08 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909829640 | 1.01E-06 | 1.01E-06 | mr1981_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |