\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909829640:

Variant ID: vg0909829640 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9829640
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCGGACGTTCGGGTGTTTGGCACACGTCAAGACCACCACGCCGAATGTCAAGAAGCTCGACGACAGGAGTAAGCCCATGATCTTTGTGGGTTATGAGCC[G/A]
GGGTCGAAGGCGTATCGCTGCTACGACCCTGCCTCTCGGCGCGTGCACATCTCACGTGACGTCGCATTCGACGAAGAGGCGCAATGGAGGTGGGACGGCG

Reverse complement sequence

CGCCGTCCCACCTCCATTGCGCCTCTTCGTCGAATGCGACGTCACGTGAGATGTGCACGCGCCGAGAGGCAGGGTCGTAGCAGCGATACGCCTTCGACCC[C/T]
GGCTCATAACCCACAAAGATCATGGGCTTACTCCTGTCGTCGAGCTTCTTGACATTCGGCGTGGTGGTCTTGACGTGTGCCAAACACCCGAACGTCCGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 4.10% 0.44% 4.21% NA
All Indica  2759 97.00% 0.40% 0.47% 2.07% NA
All Japonica  1512 92.60% 0.00% 0.07% 7.34% NA
Aus  269 31.20% 65.40% 2.23% 1.12% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 99.10% 0.40% 0.00% 0.43% NA
Indica III  913 93.00% 0.50% 1.20% 5.26% NA
Indica Intermediate  786 98.30% 0.60% 0.25% 0.76% NA
Temperate Japonica  767 86.70% 0.00% 0.13% 13.17% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 68.80% 2.10% 1.04% 28.12% NA
Intermediate  90 96.70% 2.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909829640 G -> DEL LOC_Os09g16100.1 N frameshift_variant Average:24.097; most accessible tissue: Minghui63 root, score: 51.763 N N N N
vg0909829640 G -> A LOC_Os09g16100.1 synonymous_variant ; p.Pro750Pro; LOW synonymous_codon Average:24.097; most accessible tissue: Minghui63 root, score: 51.763 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909829640 NA 6.21E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 2.92E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 7.34E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 2.91E-24 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 4.97E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 1.33E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 1.26E-06 2.41E-08 mr1049_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 1.01E-06 7.99E-11 mr1344_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 2.79E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 1.06E-07 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 3.52E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 1.68E-06 1.31E-07 mr1704_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 3.56E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 4.73E-06 3.69E-11 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 NA 4.38E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909829640 1.01E-06 1.01E-06 mr1981_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251