Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909789099:

Variant ID: vg0909789099 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9789099
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTTTGTGGAAATCATGGTATTAAGGTGATTGGCATAAGCGAACGACTCTAGCTAGAAAAGTCTTTTCTTAGAGCAGGAACAATAGCAAACTAAAAGCCA[G/T]
TTATACATACATATGGAGAAGATAAAAGAAAAAAAAAGATGAGCAGCGGGTAACAGGTGTGACTATATATTAATAGTGTAGGACTCCCTCCGTTTCACAA

Reverse complement sequence

TTGTGAAACGGAGGGAGTCCTACACTATTAATATATAGTCACACCTGTTACCCGCTGCTCATCTTTTTTTTTCTTTTATCTTCTCCATATGTATGTATAA[C/A]
TGGCTTTTAGTTTGCTATTGTTCCTGCTCTAAGAAAAGACTTTTCTAGCTAGAGTCGTTCGCTTATGCCAATCACCTTAATACCATGATTTCCACAAACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.10%	6.90%	0.87%	3.07%	NA
All Indica	2759	99.40%	0.30%	0.14%	0.22%	NA
All Japonica	1512	71.20%	20.30%	2.18%	6.35%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.20%	0.10%	0.00%	0.66%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	94.70%	0.70%	1.56%	3.13%	NA
Tropical Japonica	504	29.20%	55.80%	3.77%	11.31%	NA
Japonica Intermediate	241	84.20%	8.70%	0.83%	6.22%	NA
VI/Aromatic	96	63.50%	0.00%	1.04%	35.42%	NA
Intermediate	90	72.20%	15.60%	3.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909789099	G -> DEL	N	N	silent_mutation	Average:45.247; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0909789099	G -> T	LOC_Os09g16020.1	downstream_gene_variant ; 2955.0bp to feature; MODIFIER	silent_mutation	Average:45.247; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0909789099	G -> T	LOC_Os09g16030.1	downstream_gene_variant ; 1332.0bp to feature; MODIFIER	silent_mutation	Average:45.247; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N
vg0909789099	G -> T	LOC_Os09g16020-LOC_Os09g16030	intergenic_region ; MODIFIER	silent_mutation	Average:45.247; most accessible tissue: Minghui63 root, score: 69.344	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909789099	NA	3.23E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	7.10E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	8.98E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	7.77E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.10E-06	1.10E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	3.70E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.66E-08	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.06E-06	9.25E-09	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.12E-07	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	8.50E-06	NA	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.21E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.57E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	7.62E-07	NA	mr1145_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.07E-06	NA	mr1155_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	4.89E-06	mr1217_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	1.20E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	3.18E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	6.18E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	1.54E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	4.22E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	4.74E-07	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	9.78E-06	NA	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	1.24E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	1.41E-07	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	1.41E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	2.43E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	1.90E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909789099	NA	1.83E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251