\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909786798:

Variant ID: vg0909786798 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9786798
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTGGTGTGTAGCTAACATGTGAGTCCATGGTTTTTTTTTCCGAGATTGAATTGCCACGTAAGCGTCACATCAATGCCACGTGGGACAAAGACCCC[A/G]
TCAAAGGAAGAAACACGTAGGCGCAACATTAGCGAAAACCAGGCACAATACTGCCGAGGAATCTTGTTTACATGGTTTTGTAAGTTGGGGGATGTGTTGT

Reverse complement sequence

ACAACACATCCCCCAACTTACAAAACCATGTAAACAAGATTCCTCGGCAGTATTGTGCCTGGTTTTCGCTAATGTTGCGCCTACGTGTTTCTTCCTTTGA[T/C]
GGGGTCTTTGTCCCACGTGGCATTGATGTGACGCTTACGTGGCAATTCAATCTCGGAAAAAAAAACCATGGACTCACATGTTAGCTACACACCAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 33.10% 0.17% 0.00% NA
All Indica  2759 82.90% 16.90% 0.25% 0.00% NA
All Japonica  1512 31.70% 68.30% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.30% 0.34% 0.00% NA
Indica II  465 96.80% 2.80% 0.43% 0.00% NA
Indica III  913 64.50% 35.50% 0.00% 0.00% NA
Indica Intermediate  786 84.40% 15.30% 0.38% 0.00% NA
Temperate Japonica  767 22.80% 77.20% 0.00% 0.00% NA
Tropical Japonica  504 45.00% 55.00% 0.00% 0.00% NA
Japonica Intermediate  241 32.00% 68.00% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909786798 A -> G LOC_Os09g16010.1 downstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:91.69; most accessible tissue: Minghui63 young leaf, score: 95.476 N N N N
vg0909786798 A -> G LOC_Os09g16020.1 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:91.69; most accessible tissue: Minghui63 young leaf, score: 95.476 N N N N
vg0909786798 A -> G LOC_Os09g16030.1 downstream_gene_variant ; 3633.0bp to feature; MODIFIER silent_mutation Average:91.69; most accessible tissue: Minghui63 young leaf, score: 95.476 N N N N
vg0909786798 A -> G LOC_Os09g16020-LOC_Os09g16030 intergenic_region ; MODIFIER silent_mutation Average:91.69; most accessible tissue: Minghui63 young leaf, score: 95.476 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909786798 A G -0.03 -0.03 -0.03 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909786798 NA 7.43E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909786798 1.71E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909786798 6.12E-06 6.00E-06 mr1582 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909786798 NA 7.64E-08 mr1704 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909786798 NA 7.09E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909786798 NA 8.62E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251