Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909783541:

Variant ID: vg0909783541 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9783541
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCGGTGCCGACCGTCCGCGTGTACGAGGCCGACATCCTGGCCGTCGATTCCAACCAGAAGATCAACCATGGCGTGGCCATCTGCCATCTCGACACGTC[C/G]
GATTGGAGCCCGAATCACGGAGCCTTCATCGCGCTTGGTGGAAAACCCGGTGAGATGGAGGTGTGCCATTGGATCTTTCAAGGGGATATGACTTGGACAG

Reverse complement sequence

CTGTCCAAGTCATATCCCCTTGAAAGATCCAATGGCACACCTCCATCTCACCGGGTTTTCCACCAAGCGCGATGAAGGCTCCGTGATTCGGGCTCCAATC[G/C]
GACGTGTCGAGATGGCAGATGGCCACGCCATGGTTGATCTTCTGGTTGGAATCGACGGCCAGGATGTCGGCCTCGTACACGCGGACGGTCGGCACCGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.10% 0.19% 0.00% NA
All Indica  2759 81.00% 18.70% 0.22% 0.00% NA
All Japonica  1512 31.70% 68.20% 0.13% 0.00% NA
Aus  269 61.70% 38.30% 0.00% 0.00% NA
Indica I  595 98.00% 1.50% 0.50% 0.00% NA
Indica II  465 91.20% 8.40% 0.43% 0.00% NA
Indica III  913 64.50% 35.50% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.40% 0.13% 0.00% NA
Temperate Japonica  767 22.90% 76.90% 0.13% 0.00% NA
Tropical Japonica  504 44.80% 55.00% 0.20% 0.00% NA
Japonica Intermediate  241 32.00% 68.00% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909783541 C -> G LOC_Os09g16010.1 synonymous_variant ; p.Ser654Ser; LOW synonymous_codon Average:93.928; most accessible tissue: Callus, score: 98.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909783541 C G -0.09 -0.04 -0.05 -0.03 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909783541 NA 4.57E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909783541 4.11E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909783541 NA 5.21E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909783541 NA 5.81E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909783541 4.70E-06 6.88E-08 mr1895 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251