\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909775480:

Variant ID: vg0909775480 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9775480
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCTCATGTTTTTTTAACAAATATTTTTCTCTCACAGGGATAGGCTGTGCGAATGTGTATTCATAGGGTGGGTGTGCACACGTGTATATGAACGTCTA[C/T]
GTTTGCCTTTTACATCATTATAAAAATAATAATTTCAAAAAAATTGGCAGGATAGCGTGAAGTTGAGCCACGATGGCATGGCTTCTTCGACAGCCTCTCT

Reverse complement sequence

AGAGAGGCTGTCGAAGAAGCCATGCCATCGTGGCTCAACTTCACGCTATCCTGCCAATTTTTTTGAAATTATTATTTTTATAATGATGTAAAAGGCAAAC[G/A]
TAGACGTTCATATACACGTGTGCACACCCACCCTATGAATACACATTCGCACAGCCTATCCCTGTGAGAGAAAAATATTTGTTAAAAAAACATGAGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 5.70% 0.76% 25.41% NA
All Indica  2759 74.60% 0.30% 0.25% 24.90% NA
All Japonica  1512 62.00% 16.60% 1.46% 19.97% NA
Aus  269 30.50% 1.50% 0.37% 67.66% NA
Indica I  595 83.20% 0.50% 0.67% 15.63% NA
Indica II  465 75.10% 0.00% 0.22% 24.73% NA
Indica III  913 68.80% 0.00% 0.11% 31.11% NA
Indica Intermediate  786 74.60% 0.50% 0.13% 24.81% NA
Temperate Japonica  767 81.10% 0.90% 0.91% 17.08% NA
Tropical Japonica  504 28.20% 45.40% 1.79% 24.60% NA
Japonica Intermediate  241 71.80% 6.20% 2.49% 19.50% NA
VI/Aromatic  96 85.40% 0.00% 2.08% 12.50% NA
Intermediate  90 67.80% 7.80% 4.44% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909775480 C -> DEL N N silent_mutation Average:39.928; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg0909775480 C -> T LOC_Os09g16000.1 upstream_gene_variant ; 2047.0bp to feature; MODIFIER silent_mutation Average:39.928; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg0909775480 C -> T LOC_Os09g15980.1 downstream_gene_variant ; 2391.0bp to feature; MODIFIER silent_mutation Average:39.928; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N
vg0909775480 C -> T LOC_Os09g15980.2 intron_variant ; MODIFIER silent_mutation Average:39.928; most accessible tissue: Zhenshan97 root, score: 78.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909775480 9.88E-09 NA mr1076 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 2.84E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 3.18E-08 NA mr1082 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 1.06E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 1.62E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 2.90E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 7.31E-07 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 2.79E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 8.08E-09 NA mr1103 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 1.64E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 9.29E-06 NA mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 1.13E-09 NA mr1226 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 3.75E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 2.29E-06 NA mr1264 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 1.45E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 6.23E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 2.80E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 2.70E-11 NA mr1411 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 4.08E-06 2.91E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 2.75E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 3.92E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 5.91E-08 NA mr1949 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 5.43E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 4.88E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 1.50E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 7.71E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 2.49E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 2.62E-09 NA mr1103_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 3.56E-10 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 2.33E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 4.02E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 5.45E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909775480 NA 4.54E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251