\
| Variant ID: vg0909705729 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9705729 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACGTGGATCTGAATGTCAACATTGTCGTTTGTGTACCCCGGCCGGTCCTGGACGATGATTTTAATGCACATTCTGCTTGGAATTCTATTCGGGAATTT[T/C]
TGGGCGTGACAGCCATGAGCCCTACGATGTACCCGAACATGGAGGAATACGAAGGACGGACATGGCTGTCACCACCTGTCGTCTACCTCACTTTTTTGGA
TCCAAAAAAGTGAGGTAGACGACAGGTGGTGACAGCCATGTCCGTCCTTCGTATTCCTCCATGTTCGGGTACATCGTAGGGCTCATGGCTGTCACGCCCA[A/G]
AAATTCCCGAATAGAATTCCAAGCAGAATGTGCATTAAAATCATCGTCCAGGACCGGCCGGGGTACACAAACGACAATGTTGACATTCAGATCCACGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 35.40% | 0.49% | 25.48% | NA |
| All Indica | 2759 | 58.50% | 16.80% | 0.69% | 24.07% | NA |
| All Japonica | 1512 | 5.30% | 74.50% | 0.13% | 20.04% | NA |
| Aus | 269 | 29.40% | 5.20% | 0.74% | 64.68% | NA |
| Indica I | 595 | 80.30% | 4.00% | 0.50% | 15.13% | NA |
| Indica II | 465 | 72.50% | 2.60% | 0.86% | 24.09% | NA |
| Indica III | 913 | 36.10% | 32.30% | 0.77% | 30.78% | NA |
| Indica Intermediate | 786 | 59.50% | 16.80% | 0.64% | 23.03% | NA |
| Temperate Japonica | 767 | 1.80% | 81.40% | 0.13% | 16.69% | NA |
| Tropical Japonica | 504 | 11.10% | 64.70% | 0.20% | 24.01% | NA |
| Japonica Intermediate | 241 | 4.10% | 73.40% | 0.00% | 22.41% | NA |
| VI/Aromatic | 96 | 25.00% | 30.20% | 0.00% | 44.79% | NA |
| Intermediate | 90 | 34.40% | 43.30% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909705729 | T -> DEL | N | N | silent_mutation | Average:24.029; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0909705729 | T -> C | LOC_Os09g15890.1 | upstream_gene_variant ; 4476.0bp to feature; MODIFIER | silent_mutation | Average:24.029; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0909705729 | T -> C | LOC_Os09g15880.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.029; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909705729 | 6.38E-07 | 1.21E-07 | mr1119 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909705729 | 5.79E-06 | 1.68E-06 | mr1247 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909705729 | NA | 2.45E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909705729 | 2.19E-06 | NA | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909705729 | NA | 6.99E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909705729 | NA | 2.27E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |