\
| Variant ID: vg0909417437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9417437 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCTTCGCCTTATAACTCCATCTCCAGCGCCTCTTATGCCATTAGATCTCCATCTCCGACGATGTTTTCCTCATAGCTCCTGCATTCCAATTTCCATTTC[A/G]
GCATCCAATTGGAAGGTATTATCTCTAATGGTTCTAGCCTTTGAACAAAACAAATCAGCTATAAACTAGATTTCATCTTGAGCATTGTGTTCCTCCTTTT
AAAAGGAGGAACACAATGCTCAAGATGAAATCTAGTTTATAGCTGATTTGTTTTGTTCAAAGGCTAGAACCATTAGAGATAATACCTTCCAATTGGATGC[T/C]
GAAATGGAAATTGGAATGCAGGAGCTATGAGGAAAACATCGTCGGAGATGGAGATCTAATGGCATAAGAGGCGCTGGAGATGGAGTTATAAGGCGAAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 3.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909417437 | A -> G | LOC_Os09g15389.1 | downstream_gene_variant ; 2667.0bp to feature; MODIFIER | silent_mutation | Average:34.549; most accessible tissue: Callus, score: 78.364 | N | N | N | N |
| vg0909417437 | A -> G | LOC_Os09g15389.2 | downstream_gene_variant ; 4377.0bp to feature; MODIFIER | silent_mutation | Average:34.549; most accessible tissue: Callus, score: 78.364 | N | N | N | N |
| vg0909417437 | A -> G | LOC_Os09g15380-LOC_Os09g15389 | intergenic_region ; MODIFIER | silent_mutation | Average:34.549; most accessible tissue: Callus, score: 78.364 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909417437 | NA | 6.04E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909417437 | NA | 1.14E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909417437 | NA | 5.69E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909417437 | 2.29E-06 | 2.30E-06 | mr1994 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |