\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909396914:

Variant ID: vg0909396914 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9396914
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.32, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGTATATAATCTGTGTGTCACCATCTCTCATTCATCTTGTGCACCCCATTGACGCATTTCTTTTATTATTTTCAGGTGGTGATGCAAAATGCAAAAT[A/G]
CAACATTCTTTGTAGATAGAAAATCAGGCAATTATATTGAAGCAACCTCATATATGCTTAGATGATAGAAAAGCTGTATAGGGTTAGTATATGCAAAGGT

Reverse complement sequence

ACCTTTGCATATACTAACCCTATACAGCTTTTCTATCATCTAAGCATATATGAGGTTGCTTCAATATAATTGCCTGATTTTCTATCTACAAAGAATGTTG[T/C]
ATTTTGCATTTTGCATCACCACCTGAAAATAATAAAAGAAATGCGTCAATGGGGTGCACAAGATGAATGAGAGATGGTGACACACAGATTATATACTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.70% 5.90% 0.61% 64.75% NA
All Indica  2759 6.00% 3.60% 0.98% 89.45% NA
All Japonica  1512 72.90% 0.20% 0.00% 26.92% NA
Aus  269 3.70% 58.00% 0.00% 38.29% NA
Indica I  595 10.10% 0.20% 1.18% 88.57% NA
Indica II  465 2.20% 7.50% 0.65% 89.68% NA
Indica III  913 6.70% 2.80% 0.66% 89.81% NA
Indica Intermediate  786 4.30% 4.70% 1.40% 89.57% NA
Temperate Japonica  767 79.10% 0.00% 0.00% 20.86% NA
Tropical Japonica  504 71.00% 0.00% 0.00% 28.97% NA
Japonica Intermediate  241 56.80% 1.20% 0.00% 41.91% NA
VI/Aromatic  96 33.30% 17.70% 0.00% 48.96% NA
Intermediate  90 53.30% 5.60% 2.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909396914 A -> G LOC_Os09g15370.1 upstream_gene_variant ; 2198.0bp to feature; MODIFIER silent_mutation Average:9.047; most accessible tissue: Callus, score: 45.628 N N N N
vg0909396914 A -> G LOC_Os09g15365.1 downstream_gene_variant ; 592.0bp to feature; MODIFIER silent_mutation Average:9.047; most accessible tissue: Callus, score: 45.628 N N N N
vg0909396914 A -> G LOC_Os09g15360-LOC_Os09g15365 intergenic_region ; MODIFIER silent_mutation Average:9.047; most accessible tissue: Callus, score: 45.628 N N N N
vg0909396914 A -> DEL N N silent_mutation Average:9.047; most accessible tissue: Callus, score: 45.628 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909396914 NA 9.34E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 6.22E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 4.74E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 1.10E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 6.86E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 1.48E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 7.72E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 1.86E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 3.90E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 4.11E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 7.51E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 7.77E-20 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 5.76E-09 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 5.86E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 8.54E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 3.11E-06 3.11E-06 mr1688 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 9.98E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 4.16E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 4.52E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 1.05E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 2.81E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 1.33E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 7.71E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909396914 NA 7.36E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251