\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909395154:

Variant ID: vg0909395154 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9395154
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATACTATATATTAATTTTTTAATACCTAAGTAATAAATTTAAGACAATGTTGTAAAGTGCTTATAAGATTAGCTACTCCCTATTTAATTTATTTGGTT[T/C,A]
TTATCTCATGAGAGTGAAAAAGAAAAAGAAAAAATAAAAAGAAAGGAAGGAAGGGGAACGACGTACACTAACGAAGTATATGTACGTACATGAACGTACA

Reverse complement sequence

TGTACGTTCATGTACGTACATATACTTCGTTAGTGTACGTCGTTCCCCTTCCTTCCTTTCTTTTTATTTTTTCTTTTTCTTTTTCACTCTCATGAGATAA[A/G,T]
AACCAAATAAATTAAATAGGGAGTAGCTAATCTTATAAGCACTTTACAACATTGTCTTAAATTTATTACTTAGGTATTAAAAAATTAATATATAGTATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 1.10% 2.60% 7.62% NA
All Indica  2759 84.10% 1.80% 3.73% 10.40% NA
All Japonica  1512 94.00% 0.20% 1.12% 4.63% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.50% 0.70% 1.68% 2.18% NA
Indica II  465 64.30% 2.20% 6.24% 27.31% NA
Indica III  913 84.70% 3.00% 3.61% 8.76% NA
Indica Intermediate  786 86.50% 1.00% 3.94% 8.52% NA
Temperate Japonica  767 93.50% 0.00% 1.43% 5.08% NA
Tropical Japonica  504 95.40% 0.00% 0.60% 3.97% NA
Japonica Intermediate  241 92.90% 1.20% 1.24% 4.56% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 1.10% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909395154 T -> DEL N N silent_mutation Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> C LOC_Os09g15360.1 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> C LOC_Os09g15370.1 upstream_gene_variant ; 3958.0bp to feature; MODIFIER silent_mutation Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> C LOC_Os09g15365.1 downstream_gene_variant ; 2352.0bp to feature; MODIFIER silent_mutation Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> C LOC_Os09g15360-LOC_Os09g15365 intergenic_region ; MODIFIER silent_mutation Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> A LOC_Os09g15360.1 upstream_gene_variant ; 3752.0bp to feature; MODIFIER N Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> A LOC_Os09g15370.1 upstream_gene_variant ; 3958.0bp to feature; MODIFIER N Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> A LOC_Os09g15365.1 downstream_gene_variant ; 2352.0bp to feature; MODIFIER N Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0909395154 T -> A LOC_Os09g15360-LOC_Os09g15365 intergenic_region ; MODIFIER N Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909395154 NA 1.04E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 7.62E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 1.69E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 6.86E-06 2.45E-14 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 1.38E-07 9.27E-19 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 7.51E-07 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 9.36E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 1.50E-07 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 6.71E-08 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 NA 2.97E-06 mr1600_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 1.92E-09 8.21E-28 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154 4.61E-09 3.35E-27 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251