Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909395154:

Variant ID: vg0909395154 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9395154
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCATACTATATATTAATTTTTTAATACCTAAGTAATAAATTTAAGACAATGTTGTAAAGTGCTTATAAGATTAGCTACTCCCTATTTAATTTATTTGGTT[T/C,A]
TTATCTCATGAGAGTGAAAAAGAAAAAGAAAAAATAAAAAGAAAGGAAGGAAGGGGAACGACGTACACTAACGAAGTATATGTACGTACATGAACGTACA

Reverse complement sequence

TGTACGTTCATGTACGTACATATACTTCGTTAGTGTACGTCGTTCCCCTTCCTTCCTTTCTTTTTATTTTTTCTTTTTCTTTTTCACTCTCATGAGATAA[A/G,T]
AACCAAATAAATTAAATAGGGAGTAGCTAATCTTATAAGCACTTTACAACATTGTCTTAAATTTATTACTTAGGTATTAAAAAATTAATATATAGTATGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	1.10%	2.60%	7.62%	NA
All Indica	2759	84.10%	1.80%	3.73%	10.40%	NA
All Japonica	1512	94.00%	0.20%	1.12%	4.63%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.50%	0.70%	1.68%	2.18%	NA
Indica II	465	64.30%	2.20%	6.24%	27.31%	NA
Indica III	913	84.70%	3.00%	3.61%	8.76%	NA
Indica Intermediate	786	86.50%	1.00%	3.94%	8.52%	NA
Temperate Japonica	767	93.50%	0.00%	1.43%	5.08%	NA
Tropical Japonica	504	95.40%	0.00%	0.60%	3.97%	NA
Japonica Intermediate	241	92.90%	1.20%	1.24%	4.56%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	1.10%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909395154	T -> DEL	N	N	silent_mutation	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> C	LOC_Os09g15360.1	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> C	LOC_Os09g15370.1	upstream_gene_variant ; 3958.0bp to feature; MODIFIER	silent_mutation	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> C	LOC_Os09g15365.1	downstream_gene_variant ; 2352.0bp to feature; MODIFIER	silent_mutation	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> C	LOC_Os09g15360-LOC_Os09g15365	intergenic_region ; MODIFIER	silent_mutation	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> A	LOC_Os09g15360.1	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	N	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> A	LOC_Os09g15370.1	upstream_gene_variant ; 3958.0bp to feature; MODIFIER	N	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> A	LOC_Os09g15365.1	downstream_gene_variant ; 2352.0bp to feature; MODIFIER	N	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0909395154	T -> A	LOC_Os09g15360-LOC_Os09g15365	intergenic_region ; MODIFIER	N	Average:31.849; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909395154	NA	1.04E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	7.62E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	1.69E-06	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	6.86E-06	2.45E-14	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	1.38E-07	9.27E-19	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	7.51E-07	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	9.36E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	1.50E-07	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	6.71E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	NA	2.97E-06	mr1600_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	1.92E-09	8.21E-28	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909395154	4.61E-09	3.35E-27	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251