\
| Variant ID: vg0909393050 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9393050 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 72. )
GTTGGACACAGTTATTAAGAAAGTAGGTATAATTAAATAGGGAGATGTTATGTTGGGTTGAGAAGTGGAGGTAGGTGAGAAAAGTGAAAGGTGGATGATT[G/A]
TGATTAGTTGGGAAGGGAATGTTGGTGGTAATATTGTTATATTGGGACAAATCGTAAGTGCTAAAAGTTGTTATATTTTAGGACGAAGGGGGTATAAAAT
ATTTTATACCCCCTTCGTCCTAAAATATAACAACTTTTAGCACTTACGATTTGTCCCAATATAACAATATTACCACCAACATTCCCTTCCCAACTAATCA[C/T]
AATCATCCACCTTTCACTTTTCTCACCTACCTCCACTTCTCAACCCAACATAACATCTCCCTATTTAATTATACCTACTTTCTTAATAACTGTGTCCAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 12.50% | 13.31% | 32.44% | NA |
| All Indica | 2759 | 19.50% | 19.50% | 17.14% | 43.86% | NA |
| All Japonica | 1512 | 74.30% | 1.30% | 4.50% | 19.84% | NA |
| Aus | 269 | 74.00% | 3.30% | 19.33% | 3.35% | NA |
| Indica I | 595 | 17.50% | 15.50% | 17.14% | 49.92% | NA |
| Indica II | 465 | 20.60% | 12.70% | 11.83% | 54.84% | NA |
| Indica III | 913 | 19.20% | 27.60% | 19.72% | 33.52% | NA |
| Indica Intermediate | 786 | 20.70% | 17.20% | 17.30% | 44.78% | NA |
| Temperate Japonica | 767 | 79.50% | 1.20% | 4.30% | 14.99% | NA |
| Tropical Japonica | 504 | 70.80% | 0.60% | 2.78% | 25.79% | NA |
| Japonica Intermediate | 241 | 65.10% | 3.30% | 8.71% | 22.82% | NA |
| VI/Aromatic | 96 | 61.50% | 12.50% | 25.00% | 1.04% | NA |
| Intermediate | 90 | 61.10% | 11.10% | 13.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909393050 | G -> DEL | N | N | silent_mutation | Average:12.729; most accessible tissue: Callus, score: 35.001 | N | N | N | N |
| vg0909393050 | G -> A | LOC_Os09g15360.1 | upstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:12.729; most accessible tissue: Callus, score: 35.001 | N | N | N | N |
| vg0909393050 | G -> A | LOC_Os09g15365.1 | downstream_gene_variant ; 4456.0bp to feature; MODIFIER | silent_mutation | Average:12.729; most accessible tissue: Callus, score: 35.001 | N | N | N | N |
| vg0909393050 | G -> A | LOC_Os09g15360-LOC_Os09g15365 | intergenic_region ; MODIFIER | silent_mutation | Average:12.729; most accessible tissue: Callus, score: 35.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909393050 | NA | 5.11E-08 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | NA | 4.77E-09 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | NA | 6.92E-09 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | 8.42E-09 | 3.72E-17 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | 9.06E-10 | 1.75E-20 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | NA | 2.45E-06 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | NA | 5.25E-07 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | NA | 1.31E-07 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | 1.63E-13 | 8.75E-29 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909393050 | 2.96E-11 | 1.66E-26 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |