Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0909393050:

Variant ID: vg0909393050 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9393050
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGGACACAGTTATTAAGAAAGTAGGTATAATTAAATAGGGAGATGTTATGTTGGGTTGAGAAGTGGAGGTAGGTGAGAAAAGTGAAAGGTGGATGATT[G/A]
TGATTAGTTGGGAAGGGAATGTTGGTGGTAATATTGTTATATTGGGACAAATCGTAAGTGCTAAAAGTTGTTATATTTTAGGACGAAGGGGGTATAAAAT

Reverse complement sequence

ATTTTATACCCCCTTCGTCCTAAAATATAACAACTTTTAGCACTTACGATTTGTCCCAATATAACAATATTACCACCAACATTCCCTTCCCAACTAATCA[C/T]
AATCATCCACCTTTCACTTTTCTCACCTACCTCCACTTCTCAACCCAACATAACATCTCCCTATTTAATTATACCTACTTTCTTAATAACTGTGTCCAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.80%	12.50%	13.31%	32.44%	NA
All Indica	2759	19.50%	19.50%	17.14%	43.86%	NA
All Japonica	1512	74.30%	1.30%	4.50%	19.84%	NA
Aus	269	74.00%	3.30%	19.33%	3.35%	NA
Indica I	595	17.50%	15.50%	17.14%	49.92%	NA
Indica II	465	20.60%	12.70%	11.83%	54.84%	NA
Indica III	913	19.20%	27.60%	19.72%	33.52%	NA
Indica Intermediate	786	20.70%	17.20%	17.30%	44.78%	NA
Temperate Japonica	767	79.50%	1.20%	4.30%	14.99%	NA
Tropical Japonica	504	70.80%	0.60%	2.78%	25.79%	NA
Japonica Intermediate	241	65.10%	3.30%	8.71%	22.82%	NA
VI/Aromatic	96	61.50%	12.50%	25.00%	1.04%	NA
Intermediate	90	61.10%	11.10%	13.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909393050	G -> DEL	N	N	silent_mutation	Average:12.729; most accessible tissue: Callus, score: 35.001	N	N	N	N
vg0909393050	G -> A	LOC_Os09g15360.1	upstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:12.729; most accessible tissue: Callus, score: 35.001	N	N	N	N
vg0909393050	G -> A	LOC_Os09g15365.1	downstream_gene_variant ; 4456.0bp to feature; MODIFIER	silent_mutation	Average:12.729; most accessible tissue: Callus, score: 35.001	N	N	N	N
vg0909393050	G -> A	LOC_Os09g15360-LOC_Os09g15365	intergenic_region ; MODIFIER	silent_mutation	Average:12.729; most accessible tissue: Callus, score: 35.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909393050	NA	5.11E-08	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	NA	4.77E-09	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	NA	6.92E-09	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	8.42E-09	3.72E-17	mr1709	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	9.06E-10	1.75E-20	mr1709	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	NA	2.45E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	NA	5.25E-07	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	NA	1.31E-07	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	1.63E-13	8.75E-29	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050	2.96E-11	1.66E-26	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251