\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909393050:

Variant ID: vg0909393050 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9393050
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.29, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGGACACAGTTATTAAGAAAGTAGGTATAATTAAATAGGGAGATGTTATGTTGGGTTGAGAAGTGGAGGTAGGTGAGAAAAGTGAAAGGTGGATGATT[G/A]
TGATTAGTTGGGAAGGGAATGTTGGTGGTAATATTGTTATATTGGGACAAATCGTAAGTGCTAAAAGTTGTTATATTTTAGGACGAAGGGGGTATAAAAT

Reverse complement sequence

ATTTTATACCCCCTTCGTCCTAAAATATAACAACTTTTAGCACTTACGATTTGTCCCAATATAACAATATTACCACCAACATTCCCTTCCCAACTAATCA[C/T]
AATCATCCACCTTTCACTTTTCTCACCTACCTCCACTTCTCAACCCAACATAACATCTCCCTATTTAATTATACCTACTTTCTTAATAACTGTGTCCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 12.50% 13.31% 32.44% NA
All Indica  2759 19.50% 19.50% 17.14% 43.86% NA
All Japonica  1512 74.30% 1.30% 4.50% 19.84% NA
Aus  269 74.00% 3.30% 19.33% 3.35% NA
Indica I  595 17.50% 15.50% 17.14% 49.92% NA
Indica II  465 20.60% 12.70% 11.83% 54.84% NA
Indica III  913 19.20% 27.60% 19.72% 33.52% NA
Indica Intermediate  786 20.70% 17.20% 17.30% 44.78% NA
Temperate Japonica  767 79.50% 1.20% 4.30% 14.99% NA
Tropical Japonica  504 70.80% 0.60% 2.78% 25.79% NA
Japonica Intermediate  241 65.10% 3.30% 8.71% 22.82% NA
VI/Aromatic  96 61.50% 12.50% 25.00% 1.04% NA
Intermediate  90 61.10% 11.10% 13.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909393050 G -> DEL N N silent_mutation Average:12.729; most accessible tissue: Callus, score: 35.001 N N N N
vg0909393050 G -> A LOC_Os09g15360.1 upstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:12.729; most accessible tissue: Callus, score: 35.001 N N N N
vg0909393050 G -> A LOC_Os09g15365.1 downstream_gene_variant ; 4456.0bp to feature; MODIFIER silent_mutation Average:12.729; most accessible tissue: Callus, score: 35.001 N N N N
vg0909393050 G -> A LOC_Os09g15360-LOC_Os09g15365 intergenic_region ; MODIFIER silent_mutation Average:12.729; most accessible tissue: Callus, score: 35.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909393050 NA 5.11E-08 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 NA 4.77E-09 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 NA 6.92E-09 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 8.42E-09 3.72E-17 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 9.06E-10 1.75E-20 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 NA 2.45E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 NA 5.25E-07 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 NA 1.31E-07 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 1.63E-13 8.75E-29 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909393050 2.96E-11 1.66E-26 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251