Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0909378423:

Variant ID: vg0909378423 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9378423
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGTGGGGTGCAGGGGTAAAACAGGTATAACAGCCTCTCATCTACCTAGAAATAGCTTCTTTTGGGACAAGTTTGAATCCTAAAAATAGCTACATTCTA[G/A]
GACGGAGAGAGTAGATAGAATGCACAGCTGCAGTCAGAACATATGTGTAGTGAAGTGATATGATGGACTAATTAAGGGCAAAACGTGTAAGACTGGAGAG

Reverse complement sequence

CTCTCCAGTCTTACACGTTTTGCCCTTAATTAGTCCATCATATCACTTCACTACACATATGTTCTGACTGCAGCTGTGCATTCTATCTACTCTCTCCGTC[C/T]
TAGAATGTAGCTATTTTTAGGATTCAAACTTGTCCCAAAAGAAGCTATTTCTAGGTAGATGAGAGGCTGTTATACCTGTTTTACCCCTGCACCCCACAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.90% 0.02% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 52.80% 46.80% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909378423 G -> A LOC_Os09g15340.1 downstream_gene_variant ; 1322.0bp to feature; MODIFIER silent_mutation Average:92.93; most accessible tissue: Zhenshan97 flower, score: 98.004 N N N N
vg0909378423 G -> A LOC_Os09g15330-LOC_Os09g15340 intergenic_region ; MODIFIER silent_mutation Average:92.93; most accessible tissue: Zhenshan97 flower, score: 98.004 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909378423 G A 0.0 -0.02 -0.01 -0.07 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909378423 NA 9.07E-07 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 2.84E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 1.46E-18 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 3.80E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.97E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 3.54E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.91E-22 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.31E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 4.08E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 3.13E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 3.21E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 2.40E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.18E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 4.32E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 1.15E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 9.54E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 1.33E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.09E-16 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 3.69E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 2.03E-20 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 4.05E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 1.27E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 1.09E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 1.51E-10 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 2.00E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.21E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 3.88E-08 mr1777 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 8.18E-07 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909378423 NA 6.49E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251