\
| Variant ID: vg0909341959 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9341959 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )
TTAAAAGCACGAATCAAGGGGGAATCAAGGGGAAAGAGAGAGGAGGGAAAGGGGATTAATTTCCCCCAATAAATTTTGGAATCCAAGGTTTGAATCGCGC[G/A]
GATTTGAGAGAGGGAATGACTAGGTTTTCACGGGAGAGAAGAGAGAGAGGATGCCGAACGGGAGGAAGGAGACGACTGGGTGGGTGGGACCCACCGGTCG
CGACCGGTGGGTCCCACCCACCCAGTCGTCTCCTTCCTCCCGTTCGGCATCCTCTCTCTCTTCTCTCCCGTGAAAACCTAGTCATTCCCTCTCTCAAATC[C/T]
GCGCGATTCAAACCTTGGATTCCAAAATTTATTGGGGGAAATTAATCCCCTTTCCCTCCTCTCTCTTTCCCCTTGATTCCCCCTTGATTCGTGCTTTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 39.30% | 0.74% | 0.76% | NA |
| All Indica | 2759 | 31.60% | 66.00% | 1.16% | 1.30% | NA |
| All Japonica | 1512 | 99.20% | 0.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 24.70% | 73.30% | 1.68% | 0.34% | NA |
| Indica II | 465 | 18.50% | 81.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 44.10% | 53.10% | 0.55% | 2.19% | NA |
| Indica Intermediate | 786 | 29.90% | 66.40% | 1.91% | 1.78% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 24.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909341959 | G -> DEL | N | N | silent_mutation | Average:54.948; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0909341959 | G -> A | LOC_Os09g15310.1 | downstream_gene_variant ; 239.0bp to feature; MODIFIER | silent_mutation | Average:54.948; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0909341959 | G -> A | LOC_Os09g15310-LOC_Os09g15320 | intergenic_region ; MODIFIER | silent_mutation | Average:54.948; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909341959 | NA | 1.00E-45 | mr1234 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.77E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.85E-17 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 9.13E-13 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 3.76E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.77E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.71E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 9.44E-09 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.51E-10 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 4.64E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.08E-25 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 3.27E-12 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 7.15E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 3.60E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 4.43E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 9.21E-18 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 2.70E-08 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909341959 | NA | 1.43E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |