\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909341959:

Variant ID: vg0909341959 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9341959
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAAGCACGAATCAAGGGGGAATCAAGGGGAAAGAGAGAGGAGGGAAAGGGGATTAATTTCCCCCAATAAATTTTGGAATCCAAGGTTTGAATCGCGC[G/A]
GATTTGAGAGAGGGAATGACTAGGTTTTCACGGGAGAGAAGAGAGAGAGGATGCCGAACGGGAGGAAGGAGACGACTGGGTGGGTGGGACCCACCGGTCG

Reverse complement sequence

CGACCGGTGGGTCCCACCCACCCAGTCGTCTCCTTCCTCCCGTTCGGCATCCTCTCTCTCTTCTCTCCCGTGAAAACCTAGTCATTCCCTCTCTCAAATC[C/T]
GCGCGATTCAAACCTTGGATTCCAAAATTTATTGGGGGAAATTAATCCCCTTTCCCTCCTCTCTCTTTCCCCTTGATTCCCCCTTGATTCGTGCTTTTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 39.30% 0.74% 0.76% NA
All Indica  2759 31.60% 66.00% 1.16% 1.30% NA
All Japonica  1512 99.20% 0.70% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 24.70% 73.30% 1.68% 0.34% NA
Indica II  465 18.50% 81.10% 0.43% 0.00% NA
Indica III  913 44.10% 53.10% 0.55% 2.19% NA
Indica Intermediate  786 29.90% 66.40% 1.91% 1.78% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909341959 G -> DEL N N silent_mutation Average:54.948; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0909341959 G -> A LOC_Os09g15310.1 downstream_gene_variant ; 239.0bp to feature; MODIFIER silent_mutation Average:54.948; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0909341959 G -> A LOC_Os09g15310-LOC_Os09g15320 intergenic_region ; MODIFIER silent_mutation Average:54.948; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909341959 NA 1.00E-45 mr1234 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.77E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.85E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 9.13E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 3.76E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.77E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.71E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 9.44E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.51E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 4.64E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.08E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 3.27E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 7.15E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 3.60E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 4.43E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 9.21E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 2.70E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909341959 NA 1.43E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251