\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909336609:

Variant ID: vg0909336609 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9336609
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGGGTGCGGGTGTTCGAGGTCCGTTTTCAGAAAATACGATAAATGCAAAAAGCCAAATGATGTAAATACGTTCGGGCCATGAGGAAGCATAACACCCT[G/A]
CTGTTTTGTTCTTGACTATATCTGAGATTATCGAGGATTACAAGGTGTGGATGTGTTCTCTCTTGGTTCTGGTTACTACTCTCATGATTTCCAGGAGAGA

Reverse complement sequence

TCTCTCCTGGAAATCATGAGAGTAGTAACCAGAACCAAGAGAGAACACATCCACACCTTGTAATCCTCGATAATCTCAGATATAGTCAAGAACAAAACAG[C/T]
AGGGTGTTATGCTTCCTCATGGCCCGAACGTATTTACATCATTTGGCTTTTTGCATTTATCGTATTTTCTGAAAACGGACCTCGAACACCCGCACCCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 7.80% 0.23% 0.47% NA
All Indica  2759 98.60% 1.40% 0.00% 0.00% NA
All Japonica  1512 85.80% 12.00% 0.73% 1.46% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 91.50% 5.90% 1.17% 1.43% NA
Tropical Japonica  504 87.10% 11.70% 0.20% 0.99% NA
Japonica Intermediate  241 64.70% 32.40% 0.41% 2.49% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909336609 G -> DEL N N silent_mutation Average:54.996; most accessible tissue: Callus, score: 71.233 N N N N
vg0909336609 G -> A LOC_Os09g15300.1 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:54.996; most accessible tissue: Callus, score: 71.233 N N N N
vg0909336609 G -> A LOC_Os09g15310.1 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:54.996; most accessible tissue: Callus, score: 71.233 N N N N
vg0909336609 G -> A LOC_Os09g15300-LOC_Os09g15310 intergenic_region ; MODIFIER silent_mutation Average:54.996; most accessible tissue: Callus, score: 71.233 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909336609 NA 5.06E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 2.07E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 2.32E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 1.30E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 9.13E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 5.58E-07 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 2.41E-06 NA mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 3.48E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 3.59E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 8.95E-07 NA mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 8.69E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 3.07E-06 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 1.05E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 3.21E-06 2.43E-09 mr1702_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 4.69E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 1.11E-07 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 4.04E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 5.50E-07 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 2.02E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 3.05E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 1.14E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 8.45E-06 8.45E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909336609 NA 3.95E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251