\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909309044:

Variant ID: vg0909309044 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9309044
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGTAGGGGGCGGTTGCGCGTCCCGGGAGGAATTCGCTTTCTTTTGTCCCAAGTTTTTTCAGGACTCTGCCGACCATGGTCGAGGTCCTACAAGTGGAGG[A/T]
GGAGGCGGTGGCGTTCACCTCCACCCCATCAGGGAGTGAGGATTCCGGCGAGAGCCGAGGTCCTCATCACCGTCGCCATGGATCTCCAACTCCTCCCCGC

Reverse complement sequence

GCGGGGAGGAGTTGGAGATCCATGGCGACGGTGATGAGGACCTCGGCTCTCGCCGGAATCCTCACTCCCTGATGGGGTGGAGGTGAACGCCACCGCCTCC[T/A]
CCTCCACTTGTAGGACCTCGACCATGGTCGGCAGAGTCCTGAAAAAACTTGGGACAAAAGAAAGCGAATTCCTCCCGGGACGCGCAACCGCCCCCTACCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 7.60% 0.11% 1.10% NA
All Indica  2759 95.60% 3.40% 0.14% 0.80% NA
All Japonica  1512 82.50% 17.30% 0.07% 0.07% NA
Aus  269 89.20% 0.00% 0.00% 10.78% NA
Indica I  595 95.50% 4.50% 0.00% 0.00% NA
Indica II  465 91.80% 2.80% 0.86% 4.52% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.80% 0.00% 0.13% NA
Temperate Japonica  767 88.80% 11.20% 0.00% 0.00% NA
Tropical Japonica  504 82.30% 17.70% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.10% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909309044 A -> DEL N N silent_mutation Average:66.247; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N
vg0909309044 A -> T LOC_Os09g15270.1 upstream_gene_variant ; 78.0bp to feature; MODIFIER silent_mutation Average:66.247; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N
vg0909309044 A -> T LOC_Os09g15260-LOC_Os09g15270 intergenic_region ; MODIFIER silent_mutation Average:66.247; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909309044 NA 8.06E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 2.68E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 5.60E-07 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 1.43E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 2.76E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 6.06E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 1.39E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 2.28E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 4.86E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 3.87E-07 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 4.36E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 7.88E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 6.74E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 1.49E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 3.02E-06 3.75E-09 mr1824_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909309044 NA 4.88E-06 mr1976_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251