\
| Variant ID: vg0909282800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9282800 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 105. )
AATGATAGGAAAAGAATTAATAATTGCTTAAATTTTTTAAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAATGGCGTCAAACATTTCAAAACGAA[G/T]
GGAGTATTTCTTTAGCATAGTTTGATGCATGTTTCTTCAGATCAGGTCAAAAAGAAAGGACCATCAAACAGAGCTGCCAGAGTAATGTAAGGCCATATGA
TCATATGGCCTTACATTACTCTGGCAGCTCTGTTTGATGGTCCTTTCTTTTTGACCTGATCTGAAGAAACATGCATCAAACTATGCTAAAGAAATACTCC[C/A]
TTCGTTTTGAAATGTTTGACGCCATTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTTAAAAAATTTAAGCAATTATTAATTCTTTTCCTATCATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.50% | 40.90% | 0.25% | 1.33% | NA |
| All Indica | 2759 | 31.00% | 68.60% | 0.33% | 0.04% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 25.50% | 73.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 20.20% | 79.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 40.20% | 59.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 30.80% | 68.70% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 41.70% | 2.10% | 1.04% | 55.21% | NA |
| Intermediate | 90 | 64.40% | 26.70% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909282800 | G -> DEL | N | N | silent_mutation | Average:29.221; most accessible tissue: Callus, score: 45.947 | N | N | N | N |
| vg0909282800 | G -> T | LOC_Os09g15260.1 | upstream_gene_variant ; 677.0bp to feature; MODIFIER | silent_mutation | Average:29.221; most accessible tissue: Callus, score: 45.947 | N | N | N | N |
| vg0909282800 | G -> T | LOC_Os09g15250-LOC_Os09g15260 | intergenic_region ; MODIFIER | silent_mutation | Average:29.221; most accessible tissue: Callus, score: 45.947 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909282800 | NA | 1.05E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909282800 | NA | 1.29E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909282800 | NA | 1.55E-08 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909282800 | NA | 3.63E-07 | mr1346_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909282800 | NA | 4.75E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909282800 | NA | 7.66E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909282800 | NA | 2.45E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |