\
| Variant ID: vg0909260803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9260803 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 245. )
AATTTTACGACCATATTACATGGGGCTATATACCTCATACCAAAATTTTGTTTGTTTTGTGCAACTTTAACTATAACAGATAGGGTTTCATGAAATTTAC[C/T]
CATTATTTTTCACGAACAAGGACTAACATTTTGTTGCTTGGCTATTAGCATAATTGGCTTAACAAGTGGCTTGAGAGCTAGTAGGATGGATCCATTATAC
GTATAATGGATCCATCCTACTAGCTCTCAAGCCACTTGTTAAGCCAATTATGCTAATAGCCAAGCAACAAAATGTTAGTCCTTGTTCGTGAAAAATAATG[G/A]
GTAAATTTCATGAAACCCTATCTGTTATAGTTAAAGTTGCACAAAACAAACAAAATTTTGGTATGAGGTATATAGCCCCATGTAATATGGTCGTAAAATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 28.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 24.50% | 75.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 17.30% | 82.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 28.00% | 72.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.80% | 59.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 34.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909260803 | C -> T | LOC_Os09g15250.1 | upstream_gene_variant ; 3403.0bp to feature; MODIFIER | silent_mutation | Average:36.974; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0909260803 | C -> T | LOC_Os09g15240-LOC_Os09g15250 | intergenic_region ; MODIFIER | silent_mutation | Average:36.974; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909260803 | NA | 3.01E-34 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 6.92E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 1.09E-11 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 1.77E-32 | mr1617_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 3.01E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 1.15E-18 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 1.54E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 2.46E-11 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 1.35E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 5.67E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 9.20E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 3.55E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 3.52E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909260803 | NA | 4.87E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |