\
| Variant ID: vg0909229224 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9229224 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.00, others allele: 0.00, population size: 254. )
GGCGGATTGGCGGAGACTGCCGCCGGTAGAGGAGAGGAGACGAGAAGACTGGAACTCGGACGGTCGCGTATGCCCGACGATTCGATCAGAAACTTGTATA[C/A,T]
ATGTATATGGTATACCTAATACATACCTAGGTCTTCTGGGCCCCTACTTTTCCTGGGCCCTAGGCCATCGCACTTCTTGCCGTAGCCCAGAGCCGGCCCT
AGGGCCGGCTCTGGGCTACGGCAAGAAGTGCGATGGCCTAGGGCCCAGGAAAAGTAGGGGCCCAGAAGACCTAGGTATGTATTAGGTATACCATATACAT[G/T,A]
TATACAAGTTTCTGATCGAATCGTCGGGCATACGCGACCGTCCGAGTTCCAGTCTTCTCGTCTCCTCTCCTCTACCGGCGGCAGTCTCCGCCAATCCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 36.40% | 63.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909229224 | C -> T | LOC_Os09g15210.1 | upstream_gene_variant ; 4475.0bp to feature; MODIFIER | N | Average:61.95; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| vg0909229224 | C -> T | LOC_Os09g15200.1 | intron_variant ; MODIFIER | N | Average:61.95; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| vg0909229224 | C -> A | LOC_Os09g15210.1 | upstream_gene_variant ; 4475.0bp to feature; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| vg0909229224 | C -> A | LOC_Os09g15200.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.95; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909229224 | NA | 6.87E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909229224 | NA | 8.33E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909229224 | 4.99E-08 | NA | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909229224 | 3.85E-07 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |