\
| Variant ID: vg0909224829 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9224829 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 100. )
TGTAGCACTATATTGTCAAACCATGAAGTAATTGGGCTCAAAACATTCGTCTCACAAAGTAGTCTCAATTTGTGTAATTAGTTATTTTTTAGCCCATATT[T/C]
AATACTTCATGCAGGCGTTCAAACGTTTGATGTAACAGTGTAAAATTTTGTGGTGGGATCTAAACAAGCCCAAAATGGTAGGAGGGCAAAGAATGAACAG
CTGTTCATTCTTTGCCCTCCTACCATTTTGGGCTTGTTTAGATCCCACCACAAAATTTTACACTGTTACATCAAACGTTTGAACGCCTGCATGAAGTATT[A/G]
AATATGGGCTAAAAAATAACTAATTACACAAATTGAGACTACTTTGTGAGACGAATGTTTTGAGCCCAATTACTTCATGGTTTGACAATATAGTGCTACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 93.30% | 6.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 16.30% | 83.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 5.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 13.20% | 86.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.10% | 86.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.20% | 66.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 57.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909224829 | T -> C | LOC_Os09g15200.1 | upstream_gene_variant ; 4169.0bp to feature; MODIFIER | silent_mutation | Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0909224829 | T -> C | LOC_Os09g15190.1 | downstream_gene_variant ; 3194.0bp to feature; MODIFIER | silent_mutation | Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0909224829 | T -> C | LOC_Os09g15190-LOC_Os09g15200 | intergenic_region ; MODIFIER | silent_mutation | Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909224829 | 3.62E-06 | NA | mr1067 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 3.50E-12 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 9.82E-11 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 4.64E-12 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 3.88E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 7.87E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 1.24E-19 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 1.92E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 6.11E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 7.89E-21 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 4.07E-14 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909224829 | NA | 4.87E-06 | mr1834_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |