\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909224829:

Variant ID: vg0909224829 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9224829
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGCACTATATTGTCAAACCATGAAGTAATTGGGCTCAAAACATTCGTCTCACAAAGTAGTCTCAATTTGTGTAATTAGTTATTTTTTAGCCCATATT[T/C]
AATACTTCATGCAGGCGTTCAAACGTTTGATGTAACAGTGTAAAATTTTGTGGTGGGATCTAAACAAGCCCAAAATGGTAGGAGGGCAAAGAATGAACAG

Reverse complement sequence

CTGTTCATTCTTTGCCCTCCTACCATTTTGGGCTTGTTTAGATCCCACCACAAAATTTTACACTGTTACATCAAACGTTTGAACGCCTGCATGAAGTATT[A/G]
AATATGGGCTAAAAAATAACTAATTACACAAATTGAGACTACTTTGTGAGACGAATGTTTTGAGCCCAATTACTTCATGGTTTGACAATATAGTGCTACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.90% 0.04% 0.00% NA
All Indica  2759 93.30% 6.60% 0.04% 0.00% NA
All Japonica  1512 16.30% 83.70% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 90.10% 9.90% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 92.10% 7.90% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 5.90% 0.13% 0.00% NA
Temperate Japonica  767 13.20% 86.80% 0.00% 0.00% NA
Tropical Japonica  504 13.10% 86.90% 0.00% 0.00% NA
Japonica Intermediate  241 33.20% 66.80% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909224829 T -> C LOC_Os09g15200.1 upstream_gene_variant ; 4169.0bp to feature; MODIFIER silent_mutation Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0909224829 T -> C LOC_Os09g15190.1 downstream_gene_variant ; 3194.0bp to feature; MODIFIER silent_mutation Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0909224829 T -> C LOC_Os09g15190-LOC_Os09g15200 intergenic_region ; MODIFIER silent_mutation Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909224829 3.62E-06 NA mr1067 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 3.50E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 9.82E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 4.64E-12 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 3.88E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 7.87E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 1.24E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 1.92E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 6.11E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 7.89E-21 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 4.07E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829 NA 4.87E-06 mr1834_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251