Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909224829:

Variant ID: vg0909224829 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9224829
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAGCACTATATTGTCAAACCATGAAGTAATTGGGCTCAAAACATTCGTCTCACAAAGTAGTCTCAATTTGTGTAATTAGTTATTTTTTAGCCCATATT[T/C]
AATACTTCATGCAGGCGTTCAAACGTTTGATGTAACAGTGTAAAATTTTGTGGTGGGATCTAAACAAGCCCAAAATGGTAGGAGGGCAAAGAATGAACAG

Reverse complement sequence

CTGTTCATTCTTTGCCCTCCTACCATTTTGGGCTTGTTTAGATCCCACCACAAAATTTTACACTGTTACATCAAACGTTTGAACGCCTGCATGAAGTATT[A/G]
AATATGGGCTAAAAAATAACTAATTACACAAATTGAGACTACTTTGTGAGACGAATGTTTTGAGCCCAATTACTTCATGGTTTGACAATATAGTGCTACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	33.90%	0.04%	0.00%	NA
All Indica	2759	93.30%	6.60%	0.04%	0.00%	NA
All Japonica	1512	16.30%	83.70%	0.00%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	90.10%	9.90%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	92.10%	7.90%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	5.90%	0.13%	0.00%	NA
Temperate Japonica	767	13.20%	86.80%	0.00%	0.00%	NA
Tropical Japonica	504	13.10%	86.90%	0.00%	0.00%	NA
Japonica Intermediate	241	33.20%	66.80%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	41.10%	57.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909224829	T -> C	LOC_Os09g15200.1	upstream_gene_variant ; 4169.0bp to feature; MODIFIER	silent_mutation	Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0909224829	T -> C	LOC_Os09g15190.1	downstream_gene_variant ; 3194.0bp to feature; MODIFIER	silent_mutation	Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0909224829	T -> C	LOC_Os09g15190-LOC_Os09g15200	intergenic_region ; MODIFIER	silent_mutation	Average:35.586; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909224829	3.62E-06	NA	mr1067	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	3.50E-12	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	9.82E-11	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	4.64E-12	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	3.88E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	7.87E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	1.24E-19	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	1.92E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	6.11E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	7.89E-21	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	4.07E-14	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909224829	NA	4.87E-06	mr1834_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251