| Variant ID: vg0909184456 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9184456 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGTAGCCTGGCTGAGTGCCTTTTTCAGCAGGCATACTTCATCATCTTCTTTTTACTTGTTTATCACGATTCCCTGAGGTTGCATATCGTCATCCCACCAC[T/C]
TGACCAGAATGGGAGGGCGAGAATCTTCAGCTGCTCGTATCCGGAGGACCTCTTCTTCATCACCAATCATTGACCCTTGTATATTCATAAAGGTGAAACA
TGTTTCACCTTTATGAATATACAAGGGTCAATGATTGGTGATGAAGAAGAGGTCCTCCGGATACGAGCAGCTGAAGATTCTCGCCCTCCCATTCTGGTCA[A/G]
GTGGTGGGATGACGATATGCAACCTCAGGGAATCGTGATAAACAAGTAAAAAGAAGATGATGAAGTATGCCTGCTGAAAAAGGCACTCAGCCAGGCTACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 1.10% | 0.57% | 2.26% | NA |
| All Indica | 2759 | 97.60% | 1.50% | 0.83% | 0.04% | NA |
| All Japonica | 1512 | 92.20% | 0.50% | 0.26% | 7.01% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 94.40% | 4.10% | 1.51% | 0.00% | NA |
| Indica III | 913 | 98.40% | 0.90% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 1.70% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 92.80% | 0.10% | 0.00% | 7.04% | NA |
| Tropical Japonica | 504 | 94.20% | 0.00% | 0.60% | 5.16% | NA |
| Japonica Intermediate | 241 | 85.90% | 2.90% | 0.41% | 10.79% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909184456 | T -> DEL | N | N | silent_mutation | Average:15.552; most accessible tissue: Callus, score: 52.982 | N | N | N | N |
| vg0909184456 | T -> C | LOC_Os09g15140.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:15.552; most accessible tissue: Callus, score: 52.982 | N | N | N | N |
| vg0909184456 | T -> C | LOC_Os09g15120.1 | downstream_gene_variant ; 4587.0bp to feature; MODIFIER | silent_mutation | Average:15.552; most accessible tissue: Callus, score: 52.982 | N | N | N | N |
| vg0909184456 | T -> C | LOC_Os09g15130.1 | downstream_gene_variant ; 1889.0bp to feature; MODIFIER | silent_mutation | Average:15.552; most accessible tissue: Callus, score: 52.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909184456 | NA | 7.35E-06 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909184456 | 2.58E-06 | 2.58E-06 | mr1584_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909184456 | NA | 5.42E-07 | mr1928_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909184456 | NA | 3.81E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |