Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909162329:

Variant ID: vg0909162329 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9162329
Reference Allele: C	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, G: 0.22, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

GACGAACTAATCGTGTAATTCATGGATTGTTTACTCTATCTATTTATTTCTGATATATTTCAACGTGATAAGTAACTGCTTATGTTCATACTATTGCTCA[C/G,T]
GTCATTTAGATTTCAAGTTGATCCTATGGGTACGATGTTATTCTTGTTTTAATATTCTAGAATCTGGTTCTGCTTAAATAATTTAAGTTCCCTGCTTGCC

Reverse complement sequence

GGCAAGCAGGGAACTTAAATTATTTAAGCAGAACCAGATTCTAGAATATTAAAACAAGAATAACATCGTACCCATAGGATCAACTTGAAATCTAAATGAC[G/C,A]
TGAGCAATAGTATGAACATAAGCAGTTACTTATCACGTTGAAATATATCAGAAATAAATAGATAGAGTAAACAATCCATGAATTACACGATTAGTTCGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	36.50%	0.15%	2.48%	T: 0.87%
All Indica	2759	92.80%	6.80%	0.11%	0.07%	T: 0.18%
All Japonica	1512	0.90%	95.80%	0.20%	3.11%	T: 0.07%
Aus	269	83.30%	3.30%	0.00%	0.37%	T: 13.01%
Indica I	595	94.60%	5.40%	0.00%	0.00%	NA
Indica II	465	92.50%	7.30%	0.00%	0.00%	T: 0.22%
Indica III	913	91.70%	8.10%	0.11%	0.11%	NA
Indica Intermediate	786	93.00%	6.10%	0.25%	0.13%	T: 0.51%
Temperate Japonica	767	0.50%	95.70%	0.26%	3.52%	NA
Tropical Japonica	504	1.20%	95.80%	0.00%	2.98%	NA
Japonica Intermediate	241	1.20%	95.90%	0.41%	2.07%	T: 0.41%
VI/Aromatic	96	7.30%	31.20%	0.00%	61.46%	NA
Intermediate	90	34.40%	55.60%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909162329	C -> G	LOC_Os09g15100-LOC_Os09g15120	intergenic_region ; MODIFIER	silent_mutation	Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0909162329	C -> DEL	N	N	silent_mutation	Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0909162329	C -> T	LOC_Os09g15100-LOC_Os09g15120	intergenic_region ; MODIFIER	silent_mutation	Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909162329	NA	8.07E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	4.92E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	1.05E-15	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	2.01E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	4.55E-19	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	3.81E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	2.19E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	6.15E-07	1.57E-50	mr1692	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	7.63E-14	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	5.58E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329	NA	5.89E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251