\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909162329:

Variant ID: vg0909162329 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9162329
Reference Allele: CAlternative Allele: G,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, G: 0.22, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


GACGAACTAATCGTGTAATTCATGGATTGTTTACTCTATCTATTTATTTCTGATATATTTCAACGTGATAAGTAACTGCTTATGTTCATACTATTGCTCA[C/G,T]
GTCATTTAGATTTCAAGTTGATCCTATGGGTACGATGTTATTCTTGTTTTAATATTCTAGAATCTGGTTCTGCTTAAATAATTTAAGTTCCCTGCTTGCC

Reverse complement sequence

GGCAAGCAGGGAACTTAAATTATTTAAGCAGAACCAGATTCTAGAATATTAAAACAAGAATAACATCGTACCCATAGGATCAACTTGAAATCTAAATGAC[G/C,A]
TGAGCAATAGTATGAACATAAGCAGTTACTTATCACGTTGAAATATATCAGAAATAAATAGATAGAGTAAACAATCCATGAATTACACGATTAGTTCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 36.50% 0.15% 2.48% T: 0.87%
All Indica  2759 92.80% 6.80% 0.11% 0.07% T: 0.18%
All Japonica  1512 0.90% 95.80% 0.20% 3.11% T: 0.07%
Aus  269 83.30% 3.30% 0.00% 0.37% T: 13.01%
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 92.50% 7.30% 0.00% 0.00% T: 0.22%
Indica III  913 91.70% 8.10% 0.11% 0.11% NA
Indica Intermediate  786 93.00% 6.10% 0.25% 0.13% T: 0.51%
Temperate Japonica  767 0.50% 95.70% 0.26% 3.52% NA
Tropical Japonica  504 1.20% 95.80% 0.00% 2.98% NA
Japonica Intermediate  241 1.20% 95.90% 0.41% 2.07% T: 0.41%
VI/Aromatic  96 7.30% 31.20% 0.00% 61.46% NA
Intermediate  90 34.40% 55.60% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909162329 C -> G LOC_Os09g15100-LOC_Os09g15120 intergenic_region ; MODIFIER silent_mutation Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg0909162329 C -> DEL N N silent_mutation Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N
vg0909162329 C -> T LOC_Os09g15100-LOC_Os09g15120 intergenic_region ; MODIFIER silent_mutation Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909162329 NA 8.07E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 4.92E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 1.05E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 2.01E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 4.55E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 3.81E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 2.19E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 6.15E-07 1.57E-50 mr1692 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 7.63E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 5.58E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909162329 NA 5.89E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251