\
| Variant ID: vg0909162329 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9162329 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, G: 0.22, others allele: 0.00, population size: 168. )
GACGAACTAATCGTGTAATTCATGGATTGTTTACTCTATCTATTTATTTCTGATATATTTCAACGTGATAAGTAACTGCTTATGTTCATACTATTGCTCA[C/G,T]
GTCATTTAGATTTCAAGTTGATCCTATGGGTACGATGTTATTCTTGTTTTAATATTCTAGAATCTGGTTCTGCTTAAATAATTTAAGTTCCCTGCTTGCC
GGCAAGCAGGGAACTTAAATTATTTAAGCAGAACCAGATTCTAGAATATTAAAACAAGAATAACATCGTACCCATAGGATCAACTTGAAATCTAAATGAC[G/C,A]
TGAGCAATAGTATGAACATAAGCAGTTACTTATCACGTTGAAATATATCAGAAATAAATAGATAGAGTAAACAATCCATGAATTACACGATTAGTTCGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 36.50% | 0.15% | 2.48% | T: 0.87% |
| All Indica | 2759 | 92.80% | 6.80% | 0.11% | 0.07% | T: 0.18% |
| All Japonica | 1512 | 0.90% | 95.80% | 0.20% | 3.11% | T: 0.07% |
| Aus | 269 | 83.30% | 3.30% | 0.00% | 0.37% | T: 13.01% |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.30% | 0.00% | 0.00% | T: 0.22% |
| Indica III | 913 | 91.70% | 8.10% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 93.00% | 6.10% | 0.25% | 0.13% | T: 0.51% |
| Temperate Japonica | 767 | 0.50% | 95.70% | 0.26% | 3.52% | NA |
| Tropical Japonica | 504 | 1.20% | 95.80% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 1.20% | 95.90% | 0.41% | 2.07% | T: 0.41% |
| VI/Aromatic | 96 | 7.30% | 31.20% | 0.00% | 61.46% | NA |
| Intermediate | 90 | 34.40% | 55.60% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909162329 | C -> G | LOC_Os09g15100-LOC_Os09g15120 | intergenic_region ; MODIFIER | silent_mutation | Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875 | N | N | N | N |
| vg0909162329 | C -> DEL | N | N | silent_mutation | Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875 | N | N | N | N |
| vg0909162329 | C -> T | LOC_Os09g15100-LOC_Os09g15120 | intergenic_region ; MODIFIER | silent_mutation | Average:30.486; most accessible tissue: Zhenshan97 young leaf, score: 41.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909162329 | NA | 8.07E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 4.92E-16 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 1.05E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 2.01E-40 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 4.55E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 3.81E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 2.19E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | 6.15E-07 | 1.57E-50 | mr1692 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 7.63E-14 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 5.58E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909162329 | NA | 5.89E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |