\
| Variant ID: vg0909128170 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9128170 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 218. )
ATGCATGGCGTTAATCCACGATTCATCAGTTAATGCATGAGTAACATCTTTGGGTACAAAAGAAGCAACAAATGCAGAATTTGCACAAACATCATGAGTC[G/A]
TTACCTTAAACATTGTAGCCCGCTCACCTATATTATCAATGATTTGTTCTCGCGGATATTGTCGTTGAATATGCAAAGTAGCAGCGACTTCTGAAGTTGT
ACAACTTCAGAAGTCGCTGCTACTTTGCATATTCAACGACAATATCCGCGAGAACAAATCATTGATAATATAGGTGAGCGGGCTACAATGTTTAAGGTAA[C/T]
GACTCATGATGTTTGTGCAAATTCTGCATTTGTTGCTTCTTTTGTACCCAAAGATGTTACTCATGCATTAACTGATGAATCGTGGATTAACGCCATGCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.40% | 44.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 89.60% | 10.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 33.10% | 66.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.40% | 11.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 70.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909128170 | G -> A | LOC_Os09g15070-LOC_Os09g15090 | intergenic_region ; MODIFIER | silent_mutation | Average:34.106; most accessible tissue: Minghui63 young leaf, score: 53.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909128170 | NA | 4.93E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 5.71E-10 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 4.48E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 5.53E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 9.66E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 1.36E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 1.33E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 3.35E-13 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 1.37E-27 | mr1323_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 1.76E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 1.40E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 6.31E-12 | mr1734_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 9.29E-12 | mr1782_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909128170 | NA | 2.82E-09 | mr1834_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |